identifier
stringlengths
1
43
dataset
stringclasses
3 values
question
stringclasses
4 values
rank
int64
0
99
url
stringlengths
14
1.88k
read_more_link
stringclasses
1 value
language
stringclasses
1 value
title
stringlengths
0
200
top_image
stringlengths
0
125k
meta_img
stringlengths
0
125k
images
listlengths
0
18.2k
movies
listlengths
0
484
keywords
listlengths
0
0
meta_keywords
listlengths
1
48.5k
tags
null
authors
listlengths
0
10
publish_date
stringlengths
19
32
summary
stringclasses
1 value
meta_description
stringlengths
0
258k
meta_lang
stringclasses
68 values
meta_favicon
stringlengths
0
20.2k
meta_site_name
stringlengths
0
641
canonical_link
stringlengths
9
1.88k
text
stringlengths
0
100k
9201
dbpedia
0
71
https://www.td.com/ca/en/personal-banking
en
Personal, Small Business Banking & Investing
[ "https://www.td.com/content/dam/tdct/images/business-banking/country-ca-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-ca-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-us-en.png", "https://www.td.com/content/dam/wealth/images/direct-investing/td-logo-en.png", "https://www.td.com/content/dam/tdct/images/personal-banking/td-logo-en.png", "https://www.td.com/content/dam/tdct/images/personal-banking/td-logo-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-ca-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-us-en.png", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1117574101/container/image.coreimg.jpeg/1706869284735/plan-your-move-to-canada.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1196290068_642740767/container/custom_teaser.coreimg.svg/1686079559763/onlinemobilesecurityguarantee-en.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1196290068_642740767/container/custom_teaser.coreimg.svg/1686079559763/onlinemobilesecurityguarantee-en.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_544403717/textimagectagrid_con/0/custom_teaser_3_colu_2064197212.coreimg.jpeg/1692683806564/youth.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_544403717/textimagectagrid_con/1/custom_teaser_3_colu_438449674.coreimg.jpeg/1699295252616/student.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_544403717/textimagectagrid_con/2/custom_teaser_3_colu.coreimg.jpeg/1692680757579/post.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1386924826/custom_teaser.coreimg.svg/1719225093197/estateplan-smp-320x180.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1386924826/custom_teaser.coreimg.svg/1719225093197/estateplan-smp-320x180.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_802282406_/textimagectagrid_con/0/custom_teaser.coreimg.svg/1667549873950/easywebtdapp-en.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_802282406_/textimagectagrid_con/1/custom_teaser.coreimg.svg/1667558254468/digitaltutorials-sm-en.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1456327964/container/textimagectagrid_con/0/custom_teaser.coreimg.jpeg/1698241824382/couple-dining-table-advice-180x180.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1456327964/container/textimagectagrid_con/1/custom_teaser.coreimg.jpeg/1667287811592/digital-tools-en.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1196290068/custom_teaser.coreimg.svg/1667548767710/manywaystobank-en.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_1196290068/custom_teaser.coreimg.svg/1667548767710/manywaystobank-en.svg", "https://www.td.com/content/dam/tdct/images/personal-banking/cepspst-38040/esg-td-entry-point.jpeg", "https://www.td.com/content/dam/tdct/images/personal-banking/ready-comitmnt-en.jpeg", "https://www.td.com/content/dam/tdcom/canada/personal-banking/home-page/tdty-24-entry-520x560-en.jpg", "https://www.td.com/content/dam/tdct/images/personal-banking/corporaterespreport-img-01-fixed-gridblock-tab-1-en.jpeg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_802282406__1636762349/textimagectagrid_con/0/custom_teaser.coreimg.svg/1668517609696/cdic-badge-bilingual-en.svg", "https://www.td.com/ca/en/personal-banking/_jcr_content/root/container/responsivegrid/container_802282406__1636762349/textimagectagrid_con/1/custom_teaser.coreimg.png/1695835189649/ciro-homepage-en.png", "https://www.td.com/etc.clientlibs/tdsite/clientlibs/clientlib-sapphire/resources/images/replay_button.png" ]
[]
[]
[ "" ]
null
[]
null
TD Canada Trust products and services include investing, mortgages, banking and small business. Featuring TD Canada Trust online banking
en
/etc.clientlibs/tdsite/clientlibs/clientlib-wealth/resources/images/wealth-favicon.ico
https://www.td.com/ca/en/personal-banking
Opening TD logo animation. We open on a dad in the kitchen. His ten-year-old son stands next to him. SON: Hey dad? DAD: Yeah, sport? SON: Can we talk about your financial plan to pay for my education? We’re now at a standing dinner party in another house. A friend of the host looks around, enamored with the house, then casually asks about her mortgage, as friends do... GUEST: I am loving the new place, heard you got a good mortgage rate. HOST: [No VO. Giggling reaction from the host.] We change scenes before she gets too into it. We’re now with a 20-something couple brushing their teeth. GIRL: We have to talk about our retirement savings. GUY: I’m convinced that the earth is flat. SUPER: 55% of Canadians avoid talking about money* LEGAL: *TD Omnibus survey conducted by Maru/Blue from November 18th to November 20th, 2022. GIRL: No... Recognizable music begins playing. We cut to see the couple sitting on green chairs across from our recurring female TD advisor in a TD branch. The couple looks relieved. ADVISOR: Don’t be afraid of the money talk… we do this kind of thing all the time. The TD advisor shows them the TD Goal Builder on a tablet. We see a longer closeup of TD Goal Builder. Cut to advisor and couple at the door. VO: Get a better understanding of your money with our new Goal Builder tool and the helpful advice of a TD advisor. Cut to the new dynamic TD end frame with the green chair. SUPER: Book an appointment today.
9201
dbpedia
2
44
https://thecommonwealth.org/history
en
Our history
https://production-new-c…9CcgEgm4wWHt807D
https://production-new-c…9CcgEgm4wWHt807D
[ "https://thecommonwealth.org/themes/custom/cd_starter_kit/logo.svg", "https://thecommonwealth.org/themes/custom/cd_starter_kit/images/chogm-samoa-2024.png", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/Beginning%20of%20the%20modern%20Commonwealth_0.jpg?VersionId=j5YqhMfOQXS2igjZPM7HTPmrKkNcsCRH&itok=YsKchnbk", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-08/1746-21113671%20%281%29.jpeg?VersionId=ft2iT0k69O6JDdBWWWknAszbJTR196Zz&itok=U2Ov0-lR", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/ghana620.jpg?VersionId=BMjvk7TZFOnXoLkODy3CzOEX_WN3eF23&itok=b8jERV-b", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%283%29_0.png?VersionId=i3RFmF3bBbXV_Fg7MFw8GRCSdpoK4S_8&itok=5x-5D-Vz", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/00001202.jpg?VersionId=C87hi7VzACfO9xIXydEYugPX0OH.4doh&itok=Sp6f4wYd", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/nigeria.jpg?VersionId=x9M6JBHajp2zK1lrELa1maA72mgM8rbZ&itok=WljRtkgw", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Cyprus620.jpg?VersionId=RDtu4gFTzUwcAbyE3ECCYPL3I5vHikDy&itok=PWFENeUO", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Sierra_Leone620.png?VersionId=mt4RLkeLQidna4WEFwkR2E_g62EJm6vw&itok=qxqTeXdu", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Tanzania%20%283x5%29.png?VersionId=T9MJvR_hE5mqxtAqUFKRL.WdAwDZFs7j&itok=NP2CpqME", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Jamaica%20%283x5%29.png?VersionId=KkwuX3brtyUeSD0Tbv5qPkQ3HPbBGcr7&itok=eSQ_75sV", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Trinidad_and_Tobago620.jpg?VersionId=tJL6mgDrFs4U2dj.jl5ccH_zYxc3.ms9&itok=RzEoaML7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/flag_0.png?VersionId=PTvFTuy0mTPFid4vLtrpIMYlxD9o2QuH&itok=cUN4ZhMB", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/kenya.jpg?VersionId=pjiveLFm3U6sULtuFcT6YHb_QiaGARLZ&itok=tivlo19l", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Malawi620.jpg?VersionId=N.4d9j9HTUayvphb6pMUz2Rt5u6hQZjI&itok=tlKlOLRa", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design_11.png?VersionId=HvEHEFK3ecqw13rAZLJiNqYOUzrfavql&itok=Z1PANuiQ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Zambia.jpg?VersionId=YhYHiEAMv7PPspuZhHtXidQn8OrZtbwp&itok=d4FJ4QlM", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/The_Gambia.jpg?VersionId=Z8Qa0Pim76fRxHQIop1csIwZXWu2CYfj&itok=64Rnl5UO", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/arnold%20smith.jpg?VersionId=BmREoe83B73y4p0Csmw4.MUep6RtXFaY&itok=L8-aXmdy", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/singapore620.jpg?VersionId=fyvXqYmJKKJj0utX0wdAsAezdAzktFZA&itok=OW_0KM_j", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/Commonwealth%20Foundation%20logo.png?VersionId=rGRRElLxgRHfS1sDZS4.Gvqf_pWYsYoP&itok=1XNoZfx7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/Law%20Ministers%20Meeting%201966.jpg?VersionId=RmDoz_keGXhQ_F.VVwMbvewOkSOl83yI&itok=3GuCI7bq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Guyana%20%283x5%29.png?VersionId=vbsDS904SfeCA1zr9ZvbxXu5vnz4wbee&itok=FG0_P2Nk", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Botswana_620.jpg?VersionId=Yka34OdGK8RztzPPIoRKpvEhZDGbeMYx&itok=EL4AsWpp", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Lesotho620.jpg?VersionId=fDakYv25SCPDiBpjRliteAaqjT8xNR2s&itok=6UyRTtZP", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Barbados620.jpg?VersionId=W06E1WfRywLdWYSjHV9mE5aXtdCmDKG3&itok=Q49j_37R", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Mauritius620.jpg?VersionId=CP.ftriBUTEw3DZEEH5EmLf.roUGjbiT&itok=Kepsc4_5", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%281%29_4.png?VersionId=SJJA0r3rEuJmkBxYY3vHt4jMnwHVAC1f&itok=5lWnQVeQ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Nauru620.jpg?VersionId=6SI8JVi5YXlV3ngUwKte.oS3OzlOEjSS&itok=BNnZ_lYq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Tonga620.jpg?VersionId=fnmsNBVR45dGOdTZ0PT_7ov9c.ZY2qA7&itok=zuRpy4sB", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/flag%20%288%29.png?VersionId=DjvjLk_DuuUZhfVrY3p2as3wWh6UXA9X&itok=Uem11TH9", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Fiji.png?VersionId=5W8qixeD9tAMwaUnnMUE2shK_EhZ4wYS&itok=kCvcRTW6", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/cftc.jpg?VersionId=pVfI0i6Ckgc1VHUXY0oWwVI0zw6AXrt0&itok=n3My0JY0", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/singaporeCHOGM.jpg?VersionId=3Iug_cFssLL7ZLBviJZfRLyMoRGz31kw&itok=mZa36tzi", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/singapore-declaration.jpg?VersionId=1ussn8vCuGs0vpXbe0mobedpCb9lkKnb&itok=xiC2vrLl", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Pakistan.png?VersionId=YqQBg9BwTlqNoVtEWF47jkmC1W5HC5N3&itok=trGRGvf7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Bangladesh.png?VersionId=UEMBoIyh7QTM2N7nMV6f49ylSD4XkZVg&itok=15gHEjZ2", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/Senior%20Officials%20Meeting%201973.jpg?VersionId=fIC8SXEAemMHd1fcnIaQ4yEfaAbbjqj2&itok=tuMWYIxU", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/monwealth_Youth_Parliament_at_the_8252462278_l.jpg?VersionId=MA6xH8FrNcyk.ec_4C.Ya3rWQncHXY7r&itok=ueyy3m7q", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/Youth%20Ministers%20Meeting%201973_0.jpg?VersionId=M7wOxcyd57.ICMH0juXvUJKXfTFFuWyy&itok=V7f4Nuo9", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/bahamas.jpg?VersionId=Tpnbmqdx4OZG2_wfEKaBuxqx8G089a_f&itok=hBWoImAW", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/canadaCHOGM.jpg?VersionId=8oa5ZMweA.Y246RHvkT.P6d7qj5I4uy9&itok=8fUgTUsk", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Grenada.png?VersionId=qF67Up2eZHMarj2nfh9JNQiFyVuyqKC8&itok=NmDu2SwY", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/KingstonCHOGM.jpg?VersionId=ba8y2KVu9ud1Ehq5tSAl619zCg8mbusu&itok=TDiKxXnA", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Ramphal.jpg?VersionId=2AONniFF5l01E315lNLxM1wKgPfY5J93&itok=0zkt6138", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/png.jpg?VersionId=MlOhtiD0gfgOfRiv2tS2xiqXCu0RAHLV&itok=R2t-Kiai", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Seychelles.png?VersionId=hKJxtmuGklIvt6jQe31W4Wlp8oFe.sGc&itok=5GsXkPaZ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Invitation1977.jpg?VersionId=vaYwLrze05B9UdFiPKYo3rwKywVPQRNr&itok=8q82rOjo", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/LondonCHOGM.jpg?VersionId=olGitYkibiTsr95NZCItnkh6tkIM1dRc&itok=Ssw2E4Kq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/gleneagles.jpg?VersionId=JzUk.s3YOjTLiVPgz2T1AiXOAlqeFMkJ&itok=f_2ao7vx", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Solomon.png?VersionId=BNmpqncJTMu7sPB2nN9cXy6gmLREhRIb&itok=2c4aiZom", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Tuvalu.png?VersionId=jTKd1zzoWjrcZ2gUkID8w0r34frsRe1B&itok=q-nP5SjQ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/dominica-hi.jpg?VersionId=VlOPCntPESaBLM07i5.qRn1.xxBy.Icu&itok=Yv4F_9VJ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Saint_Lucia620.jpg?VersionId=gVQ9QUYCCfnBJ034YdUHlrZYU88Lc_71&itok=F-tYd1bJ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Kiribati620.jpg?VersionId=2pRCXsVZZB_ghhRLjbTcyJUKhP09T_3Q&itok=CvlxvpSv", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-04/1979%20CHOGM.png?VersionId=E0ahfXsz..X21TU2By729HEcQFNQvNHV&itok=sD8KS1Tv", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/lusaka.jpg?VersionId=CR9ETqNAo3cKxyIWL0bFArQ.510KQCpY&itok=KB7hnwPb", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Saint_Vincent_and_the_Grenadines620.jpg?VersionId=SJBNPRYg7XGskIShYqWEdVrvk_zCLp5.&itok=ZCd3Cpmb", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/zimbabwe%20election%20observers.jpg?VersionId=1Q4M86pv8KPGrsSBMH4YkZyrzJwfQzoV&itok=OF_9MWwg", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Zimbabwe.png?VersionId=7myzS1qFLvpDaphGQpBIokG7xRcQ3M15&itok=yTKCuD0I", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2021-10/vanuatu620.jpg?VersionId=.zSWisz_FrNLlgthwd.gGqSeBwJGM983&itok=sYDykZGv", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/un_headquarters_620.jpg?VersionId=k33FEHG3buxrjHUYon.KYrHv9wvcNrBD&itok=sxRaWcPq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Belize.png?VersionId=wkyt3wTMZIf2kowsNTznmLk0e6XubXlr&itok=WZPQjZu3", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/AusCHOGM.jpg?VersionId=daScjUnK.nj.3zPrU8c5KqlYPlo1hG3H&itok=-Ku_-7TJ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/aanb.png?VersionId=_AVOdih7jbyzL.wHG.EB7QgoWkJEmgU4&itok=gYLBoT5c", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/maldives.jpg?VersionId=ESsqNRhvaZ6mXU1vPCjw5fHD0TayMOa6&itok=nA9FdRXe", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/stkitts.jpg?VersionId=1P284pKTxZbdCd2vRNyoDeoKi3crgJNE&itok=ddrkR2M3", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/IndiaCHOGM.jpg?VersionId=bIax_JO997pJHmM6CZlJbCxcU_XnErlr&itok=zEb2Z7l3", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/cyrpus%20president%2080s.jpg?VersionId=8rQDTq2aOb_Ul5j5AGA.wHM9yuutfWtn&itok=yWmQzeuB", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/brunei.jpg?VersionId=zHbkZsKrb24ctzVteSVhv5MslNbPhMiO&itok=bujOCRbE", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/BahamasCHOGM.jpg?VersionId=xV4_C68ahwy_ulkz_3hRqNWZfqh9YgSi&itok=J56Icq00", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/nelson%20mandela.jpg?VersionId=d5aw9ZSA5Ob_BTpkRmUBhB2ptezJYSs8&itok=HJuoMWWs", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/1986.jpg?VersionId=vyxInyDq6aY0hzG7QUQatFDINwaaxZ5Z&itok=4b0QosKp", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/CanadaCHOGM2.jpg?VersionId=qrCE0gbARv276taVlgB6qfVHco6zZ2Lw&itok=rem-ZJ3R", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Fiji.png?VersionId=5W8qixeD9tAMwaUnnMUE2shK_EhZ4wYS&itok=kCvcRTW6", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/commonwealth%20of%20learning.jpg?VersionId=s8VaNrD8vSA1RQVyx4et4bNbJ975SFyZ&itok=YqR71I96", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Pakistan.png?VersionId=YqQBg9BwTlqNoVtEWF47jkmC1W5HC5N3&itok=trGRGvf7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/KLCHOGM.jpg?VersionId=4iPZM2XhlW79GG.OSmriCKJQYSJQIn0k&itok=SAQCg2rq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/emeka-anyaoku1.jpg?VersionId=l.u09cPGO37GCe56CONZBv76txNrnkXO&itok=lozwz44N", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/namibia.jpg?VersionId=F09HqMlQyxcTm0VqyZSn9ZbTcR7QcJpK&itok=_5vghVwv", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/HarareCHOGM.jpg?VersionId=Oe.DLACvdrJDT9zNMsogS0xlqmDNPgCA&itok=yQgdERyE", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/hararechogm2.jpg?VersionId=rrNXf.Xj_S95ZgLhrJ972Uli15B8YYF4&itok=MpEOHy19", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/cyprusCHOGM.jpg?VersionId=Vby8bjdIoSwzvRcgAxFfP_a.wHKeNWAn&itok=HX5JZX6G", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/00008973_0.jpg?VersionId=58J_0j2G.pRT32wZhbVR9.u3iGKxQWH9&itok=D0qVGnhJ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/mandela%201994.jpg?VersionId=.tdgZDrf.1M.pss52gOsRjddgGmZGRsd&itok=kUaZStqV", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Cameroon620.jpg?VersionId=UKvwT4yplpQb8rdb.49j64RZlh7PACGW&itok=8YDqRiAv", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/CHOGM%201995.jpg?VersionId=bknExzUn5.V0nZxslcL0UMj9UmqGNoO2&itok=O4lQoLVF", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/milbrook.jpg?VersionId=u1Uzb70_Y4nBovDe4LYz_kBDKTpVr.sM&itok=gevWPUmT", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/nwealth_Ministerial_Action_Group_CMAG_Meeting_.jpg?VersionId=6qdX5ibX7ecl9JGmQtdmax9xfpO5XY3D&itok=ovOYg3Py", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/nigeria_0.jpg?VersionId=m1eoPVTMo9OUTQ3U_6bkFWaL4xQCn5mL&itok=6LRjY7JT", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Mozambique.png?VersionId=uQGtACWXgrr4TYcxwtlfEo62Rvyj_xyf&itok=s2pgGOZn", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Fiji.png?VersionId=5W8qixeD9tAMwaUnnMUE2shK_EhZ4wYS&itok=kCvcRTW6", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/EdinburghCHOGM.jpg?VersionId=EZMm0g7bs1A0SS6uWNFiaZ9n.T4DEFao&itok=38LbG64n", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/nigeria_1.jpg?VersionId=qqgyWrCGDqHkKKh77FVWe1mX57q6BQfx&itok=QGpaxHre", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Pakistan.png?VersionId=YqQBg9BwTlqNoVtEWF47jkmC1W5HC5N3&itok=trGRGvf7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/DurbanCHOGM.jpg?VersionId=bowIqZysJvfCiUyIkz2LZsuY7Ym0gy4X&itok=xxRYnWYT", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Don-McKinnon620.jpg?VersionId=tpoZdlmnwlUiau9APlZtW2atywiLaetU&itok=Yv3czgIQ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/fiji_3.jpg?VersionId=3KD4tbcLUk9557oG0zMppzT5pf67190y&itok=mnnY5KXL", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Fiji.png?VersionId=5W8qixeD9tAMwaUnnMUE2shK_EhZ4wYS&itok=kCvcRTW6", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Zimbabwe.png?VersionId=7myzS1qFLvpDaphGQpBIokG7xRcQ3M15&itok=yTKCuD0I", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/ausCHOGM2.jpg?VersionId=hzo016ZMcHkVViBx2pesuHXUJJIPEq7d&itok=ViyKzl1b", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Zimbabwe.png?VersionId=7myzS1qFLvpDaphGQpBIokG7xRcQ3M15&itok=yTKCuD0I", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/CHOGM%20leader%202003.jpg?VersionId=raGhdrNeqkDmt4mymX52xMpKPmd8y.7I&itok=xktlMYtj", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/latimer.jpg?VersionId=inOE2F5tJGTJV0wjE1RHS84Bvk7WFcxp&itok=k350_XpJ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Pakistan.png?VersionId=YqQBg9BwTlqNoVtEWF47jkmC1W5HC5N3&itok=trGRGvf7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/observers.jpg?VersionId=LthTSqBdnbpEkied7tFmcwueIpYBuUd3&itok=Dd3ypyzj", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%283%29.png?VersionId=59Co39B4eDOzWDjETbx9i1qLfFtFIltm&itok=_0D0bgdP", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/MicrosoftTeams-image.png?VersionId=QvGiS8MykMmib3RA5IPzxNy1vSaujq3j&itok=WzMNH886", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Pakistan.png?VersionId=YqQBg9BwTlqNoVtEWF47jkmC1W5HC5N3&itok=trGRGvf7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Uganda2007.jpg?VersionId=9S4rrd1zDYrmEfuFScpGsjwxlNXmTe.w&itok=G4W9cc-u", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CW_STACKED_BLUE__HI_9_1.jpeg?VersionId=aUDJyJqBfPYe3lPIj7W5sHg4KIteRLvC&itok=VjMfmDnN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/sharma.jpg?VersionId=iq2piQsfVyBfi7lfLKKjgDve7tU54fGq&itok=5ox5LutU", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Pakistan.png?VersionId=YqQBg9BwTlqNoVtEWF47jkmC1W5HC5N3&itok=trGRGvf7", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/2008%20Group.jpg?VersionId=pMTlOa8cBm4_Fpfn_R8Vv0Dhqce7VjC4&itok=69LcXhVA", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/CHOGM%202009%20official%20photo_4138633127_l.jpg?VersionId=HIMh86IhLNjfveqj2VpFBAvg5tguJkDm&itok=guNSKVAY", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/2009CWDay.jpg?VersionId=7UDhjXhVcAxyEHSnDc4tVheKLEw5OrhH&itok=rXVbB3jX", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/celebrating_the_Commowealth_60_3479577129_l.jpg?VersionId=HQMY4o0h_TVzP.DYLvInmMslEddijXXr&itok=LuR6QREH", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Fiji.png?VersionId=5W8qixeD9tAMwaUnnMUE2shK_EhZ4wYS&itok=kCvcRTW6", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%282%29.png?VersionId=O0EaPWdMSCq8FcBzvGM34RsLgs_5r7SF&itok=JGjeLopO", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Rwanda.png?VersionId=7rX.VP1f3UcjJ6haJzQYTvqD_q.ykIG_&itok=76Lr09oN", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/2010%20sci%20and%20tech%20620.jpg?VersionId=mGhs5iYK2mQjDE_L1BgodMv7bxXZk3PR&itok=CB4SHnif", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/2011%20Women%20as%20Agents%20of%20Change%20620.jpg?VersionId=LdagQSbA6mhzqray4ODcIWNYUFzY8gO2&itok=k4uzXRDo", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/DSC_3166.JPG?VersionId=ZHdg8YCzfdtV2gXdRF6NbFlLPBpoj_ej&itok=oeaP20HO", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/CHOGM2011.jpg?VersionId=U3vI.AuDtirXKDqLFqn0hSNASFk6TtDV&itok=_Y8GEXu-", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/2012%20CConnecting-Cultures620.jpg?VersionId=FlKg.PMd7rfa30RsTDR7cHnOvkP9QRIX&itok=KMb0bbQj", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/_II_Head_of_the_Commonwealth_signs_the_charter.jpg?VersionId=bV.g.XUrp_1oMu6MKVkb0O7SIuqJOsAy&itok=r3qeiqIM", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/CW%20Day%202013.jpg?VersionId=IRnSFUDLVrR2qUWS3IY.wBOwOeXJAMeD&itok=9cMJT9Ey", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/The_Gambia_0.jpg?VersionId=gdrmJAE2vgqYkBjdzR9UuP777uy8Q9Er&itok=ekqXvxWG", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design_4.png?VersionId=t3n_6PXjmyz1Z4FGToIWwnsr4Zv5_l9O&itok=LzuADFqk", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%281%29_2.png?VersionId=myw6P0LrBRWD_cnf06AuYW9t6LFXHmg0&itok=XYO2qu-y", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Fiji.png?VersionId=5W8qixeD9tAMwaUnnMUE2shK_EhZ4wYS&itok=kCvcRTW6", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Commonwealth_Day_2015_poster.jpg?VersionId=MUFkCwaedlzMK1l8tyJJT21H7HgwTzhP&itok=PEfRuqwZ", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%281%29_1.png?VersionId=SllJHvGPy1JWcJY8R3idyBGod.093hCS&itok=NBVmm6Jn", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design_3.png?VersionId=ZuJnRLgi5qANSZHb3We8tbBv2dSaiK9X&itok=-pkgaM-F", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/theme2016.jpg?VersionId=S3a0_UtkgeWVsZzvuG4AHoh6YsnG.X75&itok=rfwlAeae", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/SGMilestone.jpg?VersionId=f1aPEGxX61pJsvb0QfNt.s0UYUZ0bWls&itok=5RhwdpWw", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-01/9M8A4350.jpg?VersionId=c.GbW1C8gkudm5ufNTGcC0l.3MSYCMRy&itok=2fh8GOM0", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Maldives_0.jpg?VersionId=FBpNo2X0pW7Ty2y5QhJFMoecPN9VZGY9&itok=ZU8f2W5U", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/CVE%20Timeline%202.jpg?VersionId=hxfTxLRzEolH0VMS6Hwo7qAWkvtfUEyq&itok=jU8yOOJF", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/Theme2017_620_0.jpg?VersionId=0647u3He9qM4Ysq96MloXWLaVQT3ElH2&itok=7XCguiSm", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%281%29_3.png?VersionId=tPQe1_TqppFHp1VdclUH6grkrH1Kcuih&itok=UYrg1TRv", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design_2.png?VersionId=rnVAwXAW7YZ1_EK9dLdmXbN0YU7JaB8z&itok=CCTes1Qq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%281%29_0.png?VersionId=h6bEMSwrojWt0b8WaSQSD3c.zGqpBBSl&itok=XDJE4Cdq", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design_1.png?VersionId=n6ryXKW9bPehKxzf70LyJO7mAauIxiPL&itok=Yk-T0Znr", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design_0.png?VersionId=cvyljbp4tyAnvP2E_L2TOU84I2rwQmGn&itok=6wNZ1pJs", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/images/maldives_0_0.jpg?VersionId=NNSU2AzCjdy8LSWD9fkkoMNefMMxJxg2&itok=RfVLDa-w", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design%20%281%29.png?VersionId=HVCjwhxktsIO5V.1GerMRMqNrO6SXTNj&itok=4IjapcAg", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-02/Untitled%20design.png?VersionId=6JXjmstOJj7X91VIB.IhWdcudp2DTXua&itok=vzHerLwx", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-08/Togo%20flag.png?VersionId=y15F6hDShnF8.I7C21IrNphu9sca.fvg&itok=qYYs-QJW", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/milestone/public/2022-08/Gabon%20flag.png?VersionId=7rRyfBO7sm_xbKU3roAwLqmSDOWmNb7h&itok=jKJ4HAFb", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/card/public/2024-08/meeting-1.png?VersionId=CPX.yErX1f1KklCjkMwwgDtu87HQxvt3&itok=vkJgTvtd", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/card/public/2024-08/dsc08805-2.jpg?VersionId=PGHMgZG2czRKnnBjVLT7jQtvLn.bCZii&itok=b5dYsuCP", "https://production-new-commonwealth-files.s3.eu-west-2.amazonaws.com/s3fs-public/styles/card/public/2024-08/international-youth-day-panel.png?VersionId=TYRwISbWl2ATd3SWgaNZBKrx4fzhhbou&itok=rRQt9__C", "https://thecommonwealth.org/themes/custom/cd_starter_kit/logo.svg" ]
[]
[]
[ "" ]
null
[]
null
Explore the history of the Commonwealth using the interactive timeline.
en
https://thecommonwealth.org/themes/custom/cd_starter_kit/favicon.ico
Commonwealth
https://thecommonwealth.org/history
The Commonwealth is one of the world’s oldest political associations of states. Its roots go back to the British Empire, when countries around the world were ruled by Britain. The early Commonwealth Over time different countries of the British Empire gained different levels of freedom from Britain. Semi-independent countries were called Dominions. Leaders of the Dominions attended conferences with Britain from 1887. The 1926 Imperial Conference was attended by the leaders of Australia, Canada, India, the Irish Free State, Newfoundland, New Zealand and South Africa. At the 1926 conference Britain and the Dominions agreed that they were all equal members of a community within the British Empire. They all owed allegiance to the British king or queen, but the United Kingdom did not rule over them. This community was called the British Commonwealth of Nations or just the Commonwealth. Birth of the modern Commonwealth The Dominions and other territories of the British Empire gradually became fully independent of the United Kingdom. India became independent in 1947. India wanted to become a republic which didn't owe allegiance to the British king or queen, but it also wanted to stay a member of the Commonwealth. At a Commonwealth Prime Ministers meeting in London in 1949, the London Declaration said that republics and other countries could be part of the Commonwealth. The modern Commonwealth of Nations was born. King George VI was the first Head of the Commonwealth, and Queen Elizabeth II became Head when he died. But the British king or queen is not automatically Head of the Commonwealth. Commonwealth member countries choose who becomes Head of the Commonwealth. Speaking on this new association in 1953 Her Majesty the Queen said: “Thus formed, the Commonwealth bears no resemblance to the Empires of the past. It is an entirely new conception, built on the highest qualities of the spirit of man: friendship, loyalty and the desire for freedom and peace. To that new conception of an equal partnership of nations and races I shall give myself heart and soul every day of my life.” The modern Commonwealth Since 1949 independent countries from Africa, the Americas, Asia, Europe and the Pacific have joined the Commonwealth. Membership today is based on free and equal voluntary co-operation. The last four countries to join the Commonwealth - Mozambique, Rwanda, Gabon and Togo - have no historical ties to the British Empire. The Commonwealth Secretariat was created in 1965 as a central intergovernmental organisation to manage the Commonwealth's work. Learn more about the Commonwealth The Commonwealth library and archives are available for historical research and study at Marlborough House in London. Stories from the Commonwealth archive Explore the archives Explore the history of the Commonwealth using the interactive timeline. Beginning of the modern Commonwealth Eight countries come together to form the modern Commonwealth. Australia, Canada, India, New Zealand, Pakistan, South Africa, Sri Lanka and the United Kingdom decided to reform their old association into the modern Commonwealth. Leaders agree that Commonwealth members are “free and equal members of the Commonwealth of Nations, freely co-operating in the pursuit of peace, liberty and progress.” First meeting of Commonwealth Finance Ministers London, United Kingdom, 21 July 1949. Ministers reviewed the economic position of the sterling area, in light of the recent fall in the level of gold and dollar reserves. Her Majesty The Queen Elizabeth II's Coronation 2 June 1953. Prime Ministers and leading citizens from across the Commonwealth attend Her Majesty The Queen's coronation at Westminster Abbey in London. Ghana joins the Commonwealth 6 March 1957 Ghana becomes the 9th country to join the Commonwealth. Malaysia joins the Commonwealth 31 August 1957. Malaysia becomes the 10th country to join the Commonwealth. First Commonwealth Education Conference 15 - 28 July 1959, Oxford, United Kingdom. The meeting of Education ministers was convened in recognition of " the great importance of education and training as an indispensable condition of development. It is an objective of Commonwealth countries that their people should be able to share as widely as possible in the advantages of education of all kinds and at all levels". Marlborough House becomes Commonwealth centre Head of the Commonwealth HM Queen Elizabeth II places Marlborough House in London, UK, at the disposal of the British Government as a Commonwealth centre. Nigeria joins the Commonwealth 1 October 1960. Nigeria becomes the 11th country to join the Commonwealth. South Africa withdraws from the Commonwealth South Africa withdraws from the Commonwealth, after pressure from member states against its apartheid policies. Republic of Cyprus joins the Commonwealth 13 March 1961 Cyprus becomes the 12th country to join the Commonwealth. Sierra Leone joins the Commonwealth 27 April 1961 Sierra Leone becomes the 13th country to join the Commonwealth. Tanzania joins the Commonwealth 9 December 1961. United Republic of Tanzania becomes the 14th country to join the Commonwealth. Jamaica joins the Commonwealth 6 August 1962. Jamaica becomes the 15th country to join the Commonwealth. Trinidad and Tobago joins the Commonwealth 31 August 1962. Trinidad and Tobago becomes the 16th country to join the Commonwealth. Uganda joins the Commonwealth 9 October 1962. Uganda becomes the 17th country to join the Commonwealth. Kenya joins the Commonwealth 12 December 1963 Kenya becomes the 18th country to join the Commonwealth. Malawi joins the Commonwealth 6 July 1964 Malawi becomes the 19th country to join the Commonwealth. Malta joins the Commonwealth 21 September 1964. Malta becomes the 20th country to join the Commonwealth Zambia joins the Commonwealth 24 October 1964 Zambia becomes the 21st country to join the Commonwealth. Commonwealth Secretariat is established Housed in Marlborough House in London, UK, the Commonwealth Secretariat was set up to be at the service of all Commonwealth Governments and as a visible symbol of the spirit of co-operation which animates the Commonwealth. The Gambia joins the Commonwealth 18 February 1965 Gambia becomes the 22nd country to join the Commonwealth. Arnold Smith becomes the first Commonwealth Secretary-General Arnold Smith of Canada becomes the first Commonwealth Secretary-General and served from 1965 to 1975. First Commonwealth Medical Conference 4 - 13 October 1965, Edinburgh, United Kingdom. Ministers concluded that "adequate medical services are an essential foundation of social and economic progress in developing countries. The Conference therefore took as its purpose a thorough review of the existing co-operation between Commonwealth countries in the fields of medicine and health and an examination of how this co-operation can be strengthened and extended." Singapore joins the Commonwealth 15 October 1965 Singapore becomes the 23rd country to join the Commonwealth. Commonwealth Foundation is established Housed in Marlborough House in London, UK, the Commonwealth Foundation was set up to administer the interchanges between Commonwealth organisations in professional fields throughout the Commonwealth. First Commonwealth Law Ministers Meeting 26 April - 3 May 1966, London, United Kingdom. The meeting reviewed arrangements for the extradition of fugitive offenders within the Commonwealth and recommended the creation of a Legal Section within the Commonwealth Secretariat. Guyana joins the Commonwealth 26 May 1966. Guyana becomes the 24th country to join the Commonwealth. First meeting of Commonwealth Trade Ministers 13 - 16 June 1966, London, United Kingdom. "It was agreed that Commonwealth countries should act in concert wherever possible in wider international organisations concerned with international trade and trade policy." Botswana joins the Commonwealth 30 September 1966 Botswana becomes the 25th country to join the Commonwealth. Lesotho joins the Commonwealth 4 October 1966 Lesotho becomes the 26th country to join the Commonwealth. Barbados joins the Commonwealth 30 November 1966 Barbados becomes the 27th country to join the Commonwealth. Mauritius joins the Commonwealth 12 March 1968 Mauritius becomes the 28th country to join the Commonwealth. Swaziland joins the Commonwealth 6 September 1968. Swaziland (now Kingdom of Eswatini) becomes the 29th country to join the Commonwealth. Nauru joins the Commonwealth 29 November 1968 Nauru becomes the 30th country to join the Commonwealth. Tonga joins the Commonwealth 4 June 1970 Tonga becomes the 31st country to join the Commonwealth. Samoa joins the Commonwealth 28 August 1970. Samoa becomes the 32nd country to join the Commonwealth. Fiji joins the Commonwealth 10 October 1970 Fiji becomes the 33rd country to join the Commonwealth. Commonwealth Fund for Technical Co-operation (CFTC) set up The Fund puts the skills of Commonwealth member countries at each other's disposal. Commonwealth Heads of Government Meeting, Singapore, Singapore 14 – 22 January 1971 First meeting of the Commonwealth Heads of Government (CHOGM). Singapore Declaration of Commonwealth Principles Commonwealth Heads of Government issued the Singapore Declaration of Commonwealth Principles at their summit in Singapore in 1971 Pakistan withdraws from the Commonwealth Bangladesh joins The Commonwealth 18 April 1972 Bangladesh becomes the 34th country to join the Commonwealth. First Commonwealth Senior Officials Meeting 16 - 19 October 1972, Ottawa, Canada. The meeting considered comparative techniques of government across the Commonwealth and tasked the Secretariat with establishing procedures for the Commonwealth Heads of Government Meetings which would ensure 'flexibility, informality and the opportunity to engage in frank discussion of common problems, even from opposing standpoints.' Commonwealth Youth Programme (CYP) fund established CYP works to engage and empower young people (ages 15-29) to enhance their contribution to development. First meeting of Commonwealth Youth Ministers 29 January 1973, Lusaka, Zambia. Ministers met to consider the creation of a Commonwealth Youth Programme. The Bahamas joins the Commonwealth 10 July 1973 The Bahamas becomes the 35th country to join the Commonwealth. Commonwealth Heads of Government Meeting, Ottawa, Canada 2 – 10 August 1973 The second meeting of the Commonwealth Heads of Government. The summit issued a Treaty Banning Nuclear Weapon Tests in the Atmosphere, in Outer Space and Under Water. Grenada joins the Commonwealth 7 February 1974 Grenada becomes the 36th country to join the Commonwealth. Commonwealth Heads of Government Meeting, Kingston, Jamaica 29 April –6 May 1975 Sir Shridath Ramphal becomes second Commonwealth Secretary-General Sir Shridath ‘Sonny’ Ramphal QC of Guyana served as Commonwealth Secretary-General from 1975 to 1990. Papua New Guinea joins the Commonwealth 16 September 1975 Papua New Guinea becomes the 37th country to join the Commonwealth. Seychelles joins the Commonwealth 28 Jun 1976 Seychelles becomes the 38th country to join the Commonwealth. First simultaneously observed Commonwealth Day Canada proposed that a “simultaneously observed Commonwealth Day would focus attention upon the association and its contribution to a harmonious global environment”. Commonwealth Heads of Government Meeting, London, UK 8 –15 June 1977 Gleneagles Agreement starts apartheid South Africa's sporting isolation Commonwealth Heads of Government issued the Gleneagles Agreement on apartheid sport at their summit in Gleneagles, Scotland on 15 June 1977. Solomon Islands joins the Commonwealth 7 July 1978 Solomon Islands becomes the 39th country to join the Commonwealth. Tuvalu joins the Commonwealth 1 October 1978 Tuvalu becomes the 40th country to join the Commonwealth. Dominica joins the Commonwealth 3 November 1978 Dominica becomes the 41st country to join the Commonwealth. St Lucia joins the Commonwealth 22 February 1979 St Lucia becomes the 42nd country to join the Commonwealth. Kiribati joins the Commonwealth 12 July 1979 Kiribati becomes the 43rd country to join the Commonwealth. Commonwealth Heads of Government Meeting, Lusaka, Zambia 1 – 7 August 1979 Lusaka Declaration on Racism and Racial Prejudice Commonwealth Heads of Government issued the Lusaka Declaration on Racism and Racial Prejudice on 7 August 1979 at their summit in Lusaka, Zambia. St Vincent and The Grenadines joins the Commonwealth 27 October 1979 St Vincent and The Grenadines becomes the 44th country to join the Commonwealth. First election observation by Commonwealth Commonwealth group observes elections for the first time in newly independent Zimbabwe Zimbabwe joins the Commonwealth 18 April 1980 Zimbabwe becomes the 45th country to join the Commonwealth. Vanuatu joins the Commonwealth 30 July 1980 Vanuatu becomes the 46th country to join the Commonwealth. Commonwealth establishes 'Small States Office' in New York Commonwealth sets up a 'Small States Office' in New York, so that small states can take part in UN negotiations. Belize joins the Commonwealth 21 September 1981 Belize becomes the 47th country to join the Commonwealth. Commonwealth Heads of Government Meeting, Melbourne, Australia 30 September – 7 October 1981 Antigua and Barbuda join the Commonwealth 1 November 1981 Antigua & Barbuda becomes the 48th country to join the Commonwealth. First Commonwealth Employment / Labour Ministers Meeting 1 June 1982, Geneva, Switzerland. Meeting in Geneva in the wings of the International Labour Conference ministers discussed the effect of the world recession on employment, particularly its impact on young people and women who were disproportionately affected. Maldives joins the Commonwealth 9 July 1982 Maldives becomes the 49th country to join the Commonwealth. St Kitts and Nevis joins the Commonwealth 19 September 1983 St Kitts & Nevis becomes the 50th country to join the Commonwealth. Commonwealth Heads of Government Meeting, New Delhi, India 23-29 November 1983 Commonwealth Action Group on Cyprus Commonwealth Action Group on Cyprus set up to assist UN Security Council efforts to resolve hostilities in Cyprus. Brunei Darussalam joins the Commonwealth 7 May 1984 Brunei Darussalam becomes the 52nd country to join the Commonwealth. First Commonwealth Women’s Affairs Ministers Meeting 13 July 1985, Nairobi, Kenya. Ministers considered means to empower national machineries and the bodies responsible for ensuring government policies and programmes addressed the needs of women. Commonwealth Heads of Government Meeting, Nassau, Bahamas 16-22 October 1985 Commonwealth Eminent Persons Group visits Nelson Mandela Commonwealth Eminent Persons Group visits Nelson Mandela in prison and sets out negotiating concept to end apartheid in South Africa peacefully. Commonwealth Heads of Government Meeting, Mini Summit, London 3-5 August, 1986 The leaders of seven Commonwealth member countries gathered to consider the report of the Commonwealth Eminent Persons Group, Mission to South Africa. They concluded that there had not been adequate progress and agreed a programme of economic sanctions against apartheid-era South Africa. Commonwealth Heads of Government Meeting, Vancouver, Canada 13-17 October 1987 Fiji's membership of The Commonwealth lapses Fiji's membership of the Commonwealth lapses after it declares itself a republic following a military coup. Commonwealth of Learning established Commonwealth governments sign a Memorandum of Understanding for the establishment of The Commonwealth of Learning on 1 September 1988. Set up in Canada, its purpose is to encourage the development and sharing of open learning/distance education knowledge, resources and technologies. Pakistan rejoins the Commonwealth Pakistan rejoins the Commonwealth after an absence of 17 years. Commonwealth Heads of Government Meeting, Kuala Lumpur, Malaysia 18-24 October 1989 Emeka Anyaoku becomes the third Commonwealth Secretary-General Emeka Anyaoku of Nigeria served as Commonwealth Secretary-General from 1990 to 2000. Namibia joins the Commonwealth 21 March 1990 Namibia becomes the 52nd country to join the Commonwealth. Commonwealth Heads of Government Meeting, Harare, Zimbabwe 16 - 21 October 1991 Harare Commonwealth Declaration The Harare Commonwealth Declaration sets the association's priorities for the 1990's and beyond. Strengthened emphasis on Commonwealth contribution to democracy, human rights and equality. Regular meeting of Commonwealth Youth Ministers begin Male, Maldives, 10 -12 May 1992. The discussions explored ways in which Ministries of Youth could be strengthened and the effectiveness of youth literacy and community service schemes improved. First Commonwealth Consultative Group of the Environment meeting New York, Unites States of America, 22 June 1993. The Secretary-General convened the meeting of Environmental officials at Ministerial level to strengthen Commonwealth dialogue and cooperation on sustainable development. Commonwealth Heads of Government Meeting, Limassol, Cyprus 21-25 October 1993 The Victoria Falls Declaration The Victoria Falls Declaration of Principles for the Promotion of the Human Rights of Women. South Africa rejoins the Commonwealth South Africa rejoins The Commonwealth following the end of apartheid. “The Commonwealth was proud to have been so closely associated with the cause of ending apartheid, for which Nelson Mandela sacrificed so many years of his life in prison," - Commonwealth Secretary-General Kamalesh Sharma in a speech that marked the 20 year anniversary of Nelson Mandela's release from incarceration. Cameroon joins the Commonwealth 1 November 1995. Cameroon becomes the 53rd country to join the Commonwealth. Commonwealth Heads of Government Meeting, Auckland, New Zealand 10-13 November 1995 Millbrook Commonwealth Action Plan on the Harare Declaration 12 November 1995. Heads of Government issued the Millbrook Commonwealth Action Plan on the Harare Declaration in New Zealand. Commonwealth Ministerial Action Group (CMAG) established Commonwealth Ministerial Action Group (CMAG) set up by Commonwealth Heads of Government in New Zealand to "deal with persistent and serious violators of the Commonwealth's shared principles". Nigeria suspended from the Commonwealth Military ruled Nigeria suspended from the Commonwealth after a 'serious violation of the principles set out in the Harare Declaration', including the execution of Ken Saro-Wiwa and ten others. Mozambique joins the Commonwealth 13 November 1995. Mozambique becomes the 54th country to join the Commonwealth. Fiji rejoins the Commonwealth "The Commonwealth responded warmly to the wish of the people of Fiji that their country resume its membership of the Commonwealth now that a new constitution has been approved which enjoys national consensus and which conforms with the Commonwealth's Harare principles." - Commonwealth Secretary-General, Chief Emeka Anyaoku. Commonwealth Heads of Government Meeting, Edinburgh, UK 24-27 October, 1997 New criteria for Commonwealth membership At their Edinburgh meeting Heads of Government received and endorsed a report from the Intergovernmental Group on Criteria for Commonwealth Membership. Chair-in-Office position created Created at the 1999 Commonwealth Heads of Government Meeting (CHOGM) in South Africa, the Chairperson-in-Office plays a representational role in intergovernmental organisations, during periods between Heads of Government meetings. In 2002, the role was extended to include Good Offices of the Secretary-General. Commonwealth celebrates 50 years 26 April 1999 marked the 50th anniversary of the Declaration of London where leaders agreed that Commonwealth members are “free and equal members of the Commonwealth of Nations, freely co-operating in the pursuit of peace, liberty and progress”. Nigeria's suspension from the Commonwealth lifted "The Commonwealth rejoices with the Nigerian people as they enter this new era. This fresh start is a victory for democracy, a victory for Nigeria - and a victory for a fundamental principle of the Commonwealth." - Commonwealth Secretary-General Chief Emeka Anyaoku. Pakistan suspended from the councils of the Commonwealth CMAG unanimously condemn the unconstitutional overthrow of the democratically elected Government of Pakistan as a serious violation of the Commonwealth's fundamental political principles. Commonwealth Heads of Government Meeting, Durban, South Africa 11-20 November, 1999. Theme: Globalisation & People-Centred Development Don McKinnon becomes fourth Commonwealth Secretary-General Sir Don McKinnon of New Zealand served as Commonwealth Secretary-General from 2000 to 2008. Fiji suspended from the councils of the Commonwealth Following the overthrow of the elected government, Fiji Islands suspended from the councils of the Commonwealth pending the restoration of democracy and the rule of law. Fiji suspension lifted Commonwealth Secretary-General Don McKinnon warmly welcomed the completion of the parliamentary elections held in Fiji Islands from 25 August to 5 September 2001. Zimbabwe suspended from the councils of the Commonwealth Zimbabwe is suspended from Commonwealth councils following the presidential election, which was marred by a high level of politically motivated violence and during which the conditions did not adequately allow for a free expression of will by the electors. Commonwealth Chairpersons' Committee on Zimbabwe set up Commonwealth Chairpersons' Committee on Zimbabwe set up by CHOGM "to determine appropriate Commonwealth action on Zimbabwe" after a highly adverse report on the Presidential elections by Commonwealth observers. First Commonwealth Sports Ministers Meeting 24 July 2002, Manchester, United Kingdom. Government ministers responsible for sport in the Commonwealth met on 24 July 2002 in Manchester on the eve of the XVIIth Commonwealth Games. Participants affirmed their commitment to the development of sport and sporting co-operation in three key areas: Anti-doping, social cohesion and women in sport. First Commonwealth Foreign Ministers Meeting 14 September 2002, New York, United States of America. Secretary-General Don McKinnon stated that "with more than half of the Commonwealth's membership made up of small states, there was concern among foreign ministers about the increasing vulnerabilities of these countries and their ability to compete in the globalised world." Commonwealth Heads of Government Meeting, Coolum, Australia 6-9 October, 2002. Theme: The Commonwealth in the 21st Century: Continuity & Renewal Zimbabwe withdraws from the Commonwealth Following the CHOGM Statement on Zimbabwe, the Government of Zimbabwe withdrew from the Commonwealth. Commonwealth Heads of Government Meeting, Abuja, Nigeria 5-8 December, 2003. Theme: Development & Democracy: Partnership for Peace & Prosperity Latimer House Principles The Commonwealth (Latimer House) Principles govern issues such as the harmonious balancing of power and the interaction between parliament, the executive and the judiciary in democratic societies. They set out in detail the consensus arrived at by representatives of the three branches of government in the Commonwealth on how each of their national institutions should interrelate in the exercise of their institutional responsibility. Pakistan suspension lifted Pakistan's suspension from the councils of the Commonwealth in 1999 is lifted. Declaration of Principles for International Election Observation "Genuine democratic elections are an expression of sovereignty, which belongs to the people of a country, the free expression of whose will provides the basis for the authority and legitimacy of government." Declaration on International Humanitarian Law 21 July 2005. Declaration of the Nairobi Meeting of Commonwealth National Committees on International Humanitarian Law. Revised Agreed Memorandum The Revised Agreed Memorandum on the establishment and functions of the Commonwealth Secretariat was first published at the conclusion of the 1965 meeting of Commonwealth Prime Ministers in London. Later amended by member governments following the 2002 meeting of Commonwealth Heads of Government in Australia, it was most recently revised following the enactment of the International Organisations Bill in the United Kingdom. Commonwealth Heads of Government Meeting, Valletta, Malta 25-27 November, 2005. Theme: Networking the Commonwealth for Development Commonwealth Ministers' Forum on Public Sector Development 26 - 27 October 2006, Sydney, Australia. The aim of the Forum was to advance public sector development in the Commonwealth, modernise governance for integrated service delivery, renew human resources for leadership development and bridge the digital divide for networked government. 'Civil Paths to Peace' launched ‘Civil Paths to Peace’ is the result of a mandate from Commonwealth leaders to look into the causes of conflict, violence and extremism in Commonwealth countries. Pakistan suspended from the Commonwealth Pakistan was suspended from the Commonwealth, following a decision of the Commonwealth Ministerial Action Group (CMAG), 22 November 2007 in Kampala, Uganda. The decision follows CMAG’s statement of 12 November to suspend Pakistan if it failed to fulfil its obligations in accordance with Commonwealth principles. Commonwealth Heads of Government Meeting, Kampala, Uganda 23-25 November 2007. Theme: Transforming Societies to Achieve Political, Economic and Human Development Criteria for Commonwealth membership revised Heads of Government reviewed the recommendations of the Committee on Commonwealth Membership from 1997 and agreed on core criteria for Membership. Commonwealth Day - Our Environment, Our Future. 10 March 2008. Secretary-General Don McKinnon said that "A far-reaching Commonwealth report in the 1980s led to the 1989 Langkawi Declaration on the environment, in which our Heads of Government said that ‘any delay in taking action to halt this progressive deterioration will result in permanent and irreversible damage’. Kamalesh Sharma becomes fifth Commonwealth Secretary-General 1 April 2008. Kamalesh Sharma of India becomes the fifth Commonwealth Secretary-General. Pakistan's suspension from councils of the Commonwealth lifted The Commonwealth Ministerial Action Group (CMAG), which addresses serious or persistent violations of the Commonwealth’s values and principles, said on 12 May 2008 that it had lifted Pakistan’s suspension from the councils of the Commonwealth with immediate effect. Commonwealth Heads of Government Meeting, Mini Summit Heads met in London from 9-10 June 2008, and then again In New York on 24 September 2008. They aimed to "identify underlying principles and the actions that should be taken, as a global priority, to achieve reform of international institutions and lead to new institutions where necessary." Commonwealth Heads of Government establish the Eminent Persons Group The Eminent Persons Group was established by Commonwealth Heads of Government at their summit in November 2009. The group’s goals are to sharpen the impact, strengthen the networks, and raise the profile of the Commonwealth. Commonwealth Day - Commonwealth at 60 9 March 2009. Secretary-General Kamalesh Sharma said that "the essence of a team is that – like the Commonwealth – its members know the advantage of working together and the strength of mutual support. The essence of a team also is that it has shared aspirations and a sense of common purpose, and relies on the range of contributions and different strengths of each of its members." Commonwealth celebrates 60th anniversary Commonwealth celebrates 60th anniversary since the London Declaration was signed and the modern Commonwealth was born. Fiji suspended from the Commonwealth Commonwealth Heads of Government Meeting, Port of Spain, Trinidad and Tobago 27 - 29 November 2009. Theme: Partnering for a more Equitable and Sustainable Future Rwanda joins the Commonwealth 29 November 2009. Rwanda becomes the 55th country to join the Commonwealth. Commonwealth Day - Science, Technology and Society 8 March 2010. Secretary-General Kamalesh Sharma said that "In the Commonwealth, we place great emphasis on ensuring that progress embraces all. It is well recognised that science and technology are integral to our future as a global community, and that future possibilities are beyond our present imagining." Commonwealth Day - Women as Agents of Change 14 March 2011. Secretary-General Kamalesh Sharma said that "Women are the barometers of society: they are an indication of its internal pressure levels, and their fortunes can be the clearest forecasts of good or bad things to come. Where women prosper, societies prosper; and where women suffer, so too do the societies in which they live." Commonwealth sets up a 'Small States Office' in Geneva The Commonwealth Small States Office provides subsidised office space for diplomatic missions of Commonwealth small states, as well as a business centre for tenants and visiting small states delegations attending multilateral meetings in Geneva. Commonwealth Heads of Government Meeting, Perth, Australia 28 - 30 October 2011. Theme: Building National Resilience, Building Global Resilience Commonwealth Day - Connecting Cultures 12 March 2012. Secretary-General Kamalesh Sharma said that "'Connecting Cultures’ is about appreciating and celebrating these ways in which others live their lives and express themselves. It is about exploring how we can bring cultures together, how we can connect them in order to learn, to deepen the appreciation we have of one another." Commonwealth Charter, signed by Her Majesty Queen Elizabeth II The Charter expresses the commitment of member states to the development of free and democratic societies and the promotion of peace and prosperity to improve the lives of all peoples of the Commonwealth. The Charter also acknowledges the role of civil society in supporting the goals and values of the Commonwealth. Commonwealth Day - Opportunity Through Enterprise 11 March 2013. Secretary-General Kamalesh Sharma said that "The Commonwealth is a unique enterprise. We work together to open up new prospects for individuals and communities, and through national, regional, and international endeavour." The Gambia withdraws from the Commonwealth Commonwealth Heads of Government Meeting, Colombo, Sri Lanka 15 - 17 November 2013. Theme: Growth with Equity; Inclusive Development Commonwealth Day - Team Commonwealth 10 March 2014. Secretary-General Kamalesh Sharma said that "the essence of a team is that – like the Commonwealth – its members know the advantage of working together and the strength of mutual support. The essence of a successful team – such as the Commonwealth – is that together it achieves more than the sum of its parts." Fiji's suspension from membership of the Commonwealth lifted Fiji was reinstated as a full member of the Commonwealth following a decision by the Commonwealth Ministerial Action Group (CMAG) at their 44th meeting in New York. Commonwealth Day - A Young Commonwealth 9 March 2015. Secretary-General Kamalesh Sharma stated, "Youth and progress through innovation are at the heart of the Commonwealth. New approaches and fresh thinking help us to realise our potential, and continually to replenish the collective wisdom that is our shared Commonwealth inheritance, and a rich resource adding global value." Commonwealth Heads of Government Meeting, Malta 27-29 November 2015. Theme: Adding Global Value Office of Civil and Criminal Justice Reform established The Commonwealth Office of Civil and Criminal Justice Reform (OCCJR) supports Commonwealth countries in delivering access to justice and sustainable development through the creation of fair and effective national laws. Commonwealth Day - An Inclusive Commonwealth 14 March 2016. In his Commonwealth Day message Secretary-General Kamalesh Sharma said that "taking strength from its diversity, the Commonwealth succeeds in creating common ground on which to stand together in answering the challenges of our times." Maldives withdraws from the Commonwealth Commonwealth Day - A Peace-building Commonwealth 13 March 2017. "Deep-rooted and resilient, Commonwealth solidarity bears us up individually and collectively. It helps us in troubled and troubling times to make the world a safer place." - Secretary-General Patricia Scotland. The Gambia rejoins the Commonwealth 8 February 2018. The Gambia today rejoined the Commonwealth, almost five years after leaving the organisation. The West Africa nation’s return was marked by a flag-raising ceremony at Marlborough House, the London headquarters of the Commonwealth Secretariat. Commonwealth Day - Towards a Common Future 12 March 2018. Secretary-General Patricia Scotland stated, “By agreeing to protect the health of oceans and marine life, and to use the precious resources they yield in responsible and sustainable ways, we will be sharing more fairly the benefits they bestow, and preserving these for future generations.” Commonwealth Heads of Government Meeting, London 16-20 April 2018. Theme: Towards a Common Future Commonwealth Day - A Connected Commonwealth 11 March 2019. The Secretary-General Patricia Scotland recalled how “From its earliest beginnings, and through successive stages of expansion and development, the Commonwealth has been a pioneer of invention and innovation, with diversity and inclusiveness as watchwords.” Commonwealth at 70 The modern Commonwealth came into being 70 years ago with the London Declaration, signed on 26 April, 1949. Across the Commonwealth, organisations are celebrating the 70th Anniversary with a series of events, conferences, competitions and workshops throughout the next year. Maldives re-joins the Commonwealth Commonwealth Secretary-General Patricia Scotland said: “We are delighted to welcome the country and its people back to the Commonwealth. The reform process underway in Maldives aligns with the values and principles of the Commonwealth and we encourage the nation to continue on this path.” Commonwealth Day - Delivering a Common Future: Connecting, Innovating, Transforming The theme for the 2020 Commonwealth Day, the Commonwealth Heads of Government Meeting (CHOGM), and for the work of the Commonwealth more generally is 'Delivering a Common Future: Connecting, Innovating, Transforming'. Commonwealth Heads of Government Meeting, Kigali, Rwanda The Commonwealth Heads of Government Meeting 2022 took place during the week of 20 June 2022, in Kigali, Rwanda. CHOGM was due to take place in June 2020 but was postponed twice due to the impact of the COVID-19 pandemic. Learn more: TheCommonwealth.org/CHOGM Togo joins the Commonwealth Togo becomes the 56th country to join the Commonwealth in June 2022 after the country's application was approved by Heads of Government at the 2022 Commonwealth Heads of Government Meeting held in Kigali, Rwanda. Gabon joins the Commonwealth Gabon becomes the 55th country to join the Commonwealth in June 2022 after the country's application was approved by Heads of Government at the 2022 Commonwealth Heads of Government Meeting held in Kigali, Rwanda. Stay up to date Subscribe to our newsletter
9201
dbpedia
1
50
https://steamcommunity.com/app/394360/discussions/0/1484358860949956376/
en
No Newfoundland? :: Hearts of Iron IV General Discussions
https://shared.steamstat…jpg?t=1721371587
https://shared.steamstat…jpg?t=1721371587
[ "https://community.akamai.steamstatic.com/public/shared/images/responsive/logo_valve_footer.png", "https://community.akamai.steamstatic.com/public/shared/images/responsive/header_menu_hamburger.png", "https://community.akamai.steamstatic.com/public/shared/images/responsive/header_logo.png", "https://community.akamai.steamstatic.com/public/shared/images/header/logo_steam.svg?t=962016", "https://cdn.akamai.steamstatic.com/steamcommunity/public/images/apps/394360/67b15e2336311b4b4f1eb5c802af0c0dbe644195.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/forum_topicicon_locked.png", "https://avatars.akamai.steamstatic.com/d331fba534a7c7149e76b4916dfca8442798881f.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/ea542b0c31cd65bafe757616c7305d1d85560687.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/d331fba534a7c7149e76b4916dfca8442798881f.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/34f0a0fb24a71fc5baf4f305531ddd88e68966f6.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/ea542b0c31cd65bafe757616c7305d1d85560687.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/d331fba534a7c7149e76b4916dfca8442798881f.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/d331fba534a7c7149e76b4916dfca8442798881f.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/34f0a0fb24a71fc5baf4f305531ddd88e68966f6.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/b3877044cdfff2ddb4288f670e0656064d9f1b2d.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/d331fba534a7c7149e76b4916dfca8442798881f.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/90f5702b78d566f8409fa74a40d26ba6ab1472b3.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/ab9712f7d960c5ae7fec46db60bd7b4db77078e4.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/225684a37757195966d0b45310e7b4d85e9e9f19.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/0c64a70c4c0bd9f7c345c58029219e91162ca03b.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/a50a40c7e9eb9fbd349cde3c80de5333aeb423ca.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://avatars.akamai.steamstatic.com/aff74dc0300911ce305c49ef7f9ff718cb0a7739.jpg", "https://community.akamai.steamstatic.com/public/images/skin_1/iconGames.png", "https://community.akamai.steamstatic.com/public/images/sharedfiles/searchbox_workshop_submit.gif", "https://community.akamai.steamstatic.com/public/images/skin_1/iconRules.png", "https://community.akamai.steamstatic.com/public/images/x9x9.gif", "https://community.akamai.steamstatic.com/public/images/skin_1/notification_icon_flag.png", "https://community.akamai.steamstatic.com/public/images/skin_1/footerLogo_valve.png?v=1" ]
[]
[]
[ "" ]
null
[]
null
Hoi4 seems to have more than a few problems. I went into it after playing EU4 thinking there would be tonnes of possibilities, but I find out they couldn't even get a 1936 map right. The Dominion of Newfoundland is missing along with other countries. I've found 2 mods which add Newfoundland in, but they screw up other things in the game, and aren't up to date either.
en
/favicon.ico
null
9201
dbpedia
3
53
https://bnaps.org/studygroups/Newfoundland/newfie_intro.htm
en
Nfld Philately 1
https://bnaps.org/images/bnaps.ico
https://bnaps.org/images/bnaps.ico
[ "https://bnaps.org/studygroups/Newfoundland/images/Image0-Map.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1a-1-2cDog.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1b-2cFishOrange.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1c-2cFishGreen.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1d-5cSeal.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image2-StudyGroupMeeting.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image3-FirstIssue.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image4-1861Cover.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image5-CentsCoverAnimals.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image6-1897-1cQV-Green.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image7-1897-1cOverprintStrip.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image8-1897RoyalFamilyProofs.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image9-1879Postcard.jpg" ]
[]
[]
[ "" ]
null
[]
null
en
https://bnaps.org/images/bnaps.ico
null
Newfoundland Philately BNAPS Newfoundland Study Group Page 1 of 2 Introduction "Newfoundland was a self-governing Dominion of the British Empire from 1855-1933, when it became a Crown Colony. In 1949 it united with Canada". - Scott Classic Stamp Catalogue, 2002 Newfoundland and Labrador are one province of Canada. Formal mail service to and from the lightly populated Labrador began in 1863 when Newfoundland let the first mail contract. Its permanent population was only 6,000 in 1949 when Newfoundland and Labrador became the 10th province of Canada. There have always been a lot more people during summer fishing season, of course. We'll see an example of a cover from Labrador in the 20th century part of this survey. Newfoundland issued almost 300 postage stamps while a Dominion and Crown Colony, about 30 pieces of postal stationery and many revenue stamps. Because of that, it provides collecting opportunities for general collectors as well as material for specialists or topical collectors. It attracts those who collect definitive or commemorative stamps, air mail stamps, postal stationery, postage dues, revenues, varieties, postal history/rates as well as those just fond of stamps from the earlier years of philately (up to 1949) before modern emanations from many countries started to inundate and discourage collectors. In the 20th century alone it issued about 200 commemorative, definitive and postage due stamps with no "wallet-busters" in that group and completion is not difficult. For the more ambitious, the air mails provide a challenge requiring more effort (and money!). Many of us - especially those who started collecting stamps as kids - can still recall our introduction to the beautiful animal stamps from Newfoundland that could be bought for pennies - the green or orange codfish, the many stamps featuring the Newfoundland dogs, blue harp seals, etc. These are fond memories that cannot be undone, and often are enough to trigger a return to philately as an adult with enough leisure time finally to spend on a hobby. These animal stamps may bring back memories of your youth. The Newfoundland Study Group In 1985, 14 dedicated philatelists formed the Newfoundland Study Group, with Clarence A. Stillions elected Chairman and editor of the Newfie Newsletter. The newsletter has come out on a regular basis ever since with over 150 issues through 2015. Editions since 2003 have included some color pages. It won the John S. Siverts Award in 2004, 2010, and 2012 for best BNAPS Study Group newsletter. Today the Study Group has over 75 members from around the world. Some members are undertaking research to enhance our knowledge of Newfoundland philately or exhibit Newfoundland stamps. Others collect stamps, or postal stationery, or varieties, or just consider themselves Newfoundland generalists. To become a member of the Study Group, one must first join BNAPS. Sammy Whaley addresses the Study Group at BNAPEX 2004 in Baltimore, MD. A Survey of Newfoundland Philately This section includes examples of the varied stamps and postal stationery of Newfoundland and reflects some areas of collecting interest of our group members. The 19th Century Newfoundland's first issue was on January 1, 1857. The 1d (or "one penny") had a central motif of the Royal Crown in profile. The stamps were recess-printed by Perkins, Bacon & Company. The 1d was imperforate and issued in sheets of 120 (12 x 10). Newfoundland's first stamp Several of our members exhibit and write extensively on the 19th century postal history of this country. The cover that follows is a very rare one from 1861 with a bisected 8d (8 pence) stamp along with a 3d (3 pence) triangle. The cover was sent from Harbour Britain to North Oxford, Mass. Take a look at the cover and then we'll explain the rate. A rare letter from 1861. Group member expert Colin Lewis explains the rate: "There were two forms of currency as legal tender in Newfoundland during this period. There was British Sterling currency and Newfoundland domestic currency. They were inter-changeable but not valued at par... To understand this cover's rate, you must know that the bisected 8 pence stamp is a Sterling value, and as such is worth 4 pence Sterling. The 3 pence triangular stamp is valued in Newfoundland currency and had a primary use of paying domestic covers up to ½ ounce. This stamp had a convertible Sterling value of 2 ½ pence. Mail sent to the U.S. had to be paid in Sterling. The rate from St. John's to Boston was 4 pence Sterling per ½ ounce but this cover was from an out-port that also required 3 pence Newfoundland currency per ½ ounce. The actual rate from such an out-port to the U.S. was 6 ½ pence Sterling. Had a 6 ½ pence stamp been available, no doubt it would have been affixed. The cover went from St. John's by steamer to Halifax, Nova Scotia, where it was carried aboard the Cunard 'Europa' to Boston". Under "An Act to Regulate The Island Post of this Colony" of April 1865, the first of the country's decimal currency stamps were issued. All stamps issued thenceforth would be in cents and dollars. Most of the remaining 19th century stamps would be printed by the American Bank Note Company of New York. The next cover shows the early images of animals used by Newfoundland - a codfish and a harp seal. Note that it also includes an example of beautiful handwriting. An 1872 cover shows cents issues, featuring animals. According to our cents-issue expert, Sammy Whaley, this cover probably originated in St. Pierre and Miquelon, but has only a St. John's date stamp. It was sent on April 1, 1872, to Harbour Grace. The fancy handwriting was by Horatio John Watts and part of a well-known correspondence to Claudius Watts. It overpaid the six-cent double inland rate by one cent. In 1897, Newfoundland decided to issue a 14-stamp set honoring John Cabot who discovered the island 400 years previously. Catering to stamp-collector interests, it hoped to duplicate the interest created by the 1893 Columbian issue of the United States. Colonial Secretary Robert Bond ordered the withdrawal of existing stamps, and the plates for this issue were destroyed shortly after its June release. The stamps were printed by the American Bank Note Company in sheets of 100 (10 x 10). The one-cent stamps showed a contemporary photograph of Queen Victoria by Bassano of London. 1897 was also the diamond jubilee of the Queen. The one-cent stamp proved too popular and was exhausted by late September, 1897. With the plates destroyed, the Post Office had a problem. One-cent stamps were needed for local covers, third-class mail and circulars, among other things. The one-cent Queen Victoria stamp of the 1897 John Cabot set. The one-cent shortage forced Newfoundland to issue its first provisionals - a one-cent surcharge on the 1890 three-cent Queen Victoria stamp. It was printed locally in St. John's. The printer used different fonts in the setting of fifty resulting in varieties that generated a lot of collector interest. There were three distinct fonts, now listed separately in catalogues. Although 40,000 stamps were surcharged, they sold quickly. From that point forward, hoards of collectors would scoop up all subsequent provisionals, hoping to discover scarce varieties. Used examples of scarcer varieties of the 1897 provisionals. This used strip is from positions 47-49 in the setting of 50. The font on the rightmost stamp is sans serif. Only two of the 50 stamps (positions 49-50) were of this rare type. A new red one-cent stamp with Queen Victoria came out on December 4, 1897, ending the shortage. The new permanent set featured portraits of the Royal Family including the first ever of Prince Edward, the future Duke of Windsor, as a baby. The stamps were issued between 1897-1901. Below we see proof pairs. Some of our members collect proofs, imperforates and specimens. Proof pairs of the 1897-1901 Royal Family set. Our quick survey of the 19th century would not be complete without an example of postal stationery. Here we see a unique example of the two-cent Queen Victoria postcard of 1879. Queen Victoria postcard of 1879. What makes this postcard unique? Our member, Rob Moore, collects Newfoundland postal stationery. He discovered this postcard, which was used on July 23, 1879. This has now been confirmed by BNA stationery experts Bill Walton and Robert Lemire as the earliest known use (EKU) of this card.
9201
dbpedia
2
48
https://journals.lib.unb.ca/index.php/acadiensis/article/view/18561/20144
en
View of Producers versus Profiteers: The Politics of Class in Newfoundland during the First World War
[]
[]
[]
[ "" ]
null
[]
null
en
null
9201
dbpedia
1
8
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
en
Dominion of Newfoundland
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
[ "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/30?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/30?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/30?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/125?cb=20110304131402", "https://static.wikia.nocookie.net/formercountries/images/f/f5/Coat_of_Arms_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/105?cb=20110304131409", "https://static.wikia.nocookie.net/formercountries/images/f/fc/Map_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/250?cb=20110304131419", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/22?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/1/14/Red_Ensign_of_Great_Britain.svg/revision/latest/scale-to-width-down/22?cb=20110304134032", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/a/a4/Flag_of_the_United_States.svg/revision/latest/scale-to-width-down/22?cb=20110228004306", "https://static.wikia.nocookie.net/6a181c72-e8bf-419b-b4db-18fd56a0eb60", "https://static.wikia.nocookie.net/6c42ce6a-b205-41f5-82c6-5011721932e7", "https://static.wikia.nocookie.net/464fc70a-5090-490b-b47e-0759e89c263f", "https://static.wikia.nocookie.net/f7bb9d33-4f9a-4faa-88fe-2a0bd8138668" ]
[]
[]
[ "" ]
null
[ "Contributors to The Countries Wiki" ]
null
The Dominion of Newfoundland was a dominion of the United Kingdom in North America.  Canada (Commonwealth realm)  British America (1607-1783)  United Kingdom: British North America (1783-1907)  Canada (From 1867)  United States World Statesmen.org Wikisource 1911 encyclopedia project Wikipedia
en
/skins-ucp/mw139/common/favicon.ico
The Countries Wiki
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
Dominion of the ‌United Kingdom ← 1907–1949 → → Motto Quaerite Prime Regnum Dei Seek ye first the kingdom of God Anthem Ode to Newfoundland Capital St. John's Status Dominion Legislature House of Assembly History - Dominion - Newfoundland Act Currency Newfoundland dollar British North America Canada Newfoundland v The Dominion of Newfoundland was a dominion of the United Kingdom in North America. Nation Canada (Commonwealth realm) Canadian Polities British America (1607-1783) United Kingdom: British North America (1783-1907) Canada (From 1867) Neighbouring Nations United States References
9201
dbpedia
0
10
http://www.numismondo.net/pm/nfl/
en
GOVERNMENT OF NEWFOUNDLAND Paper Money, 1901
http://www.numismondo.net/pm/nfl/nfl_favicon.ico
http://www.numismondo.net/pm/nfl/nfl_favicon.ico
[ "http://www.numismondo.net/pm/nfl/nfl_flag.jpg", "http://www.numismondo.net/leaders/GB/GB%20Queen%20Victoria.jpg", "http://www.numismondo.net/leaders/GB/Gbr_Edward_VII_22.1.1901-6.5.1910.jpg", "http://www.numismondo.net/leaders/GB/Lis%20GB%20King%20George%20V.jpg", "http://www.numismondo.net/pm/nfl/nfl_Gov_JohnGaspard%20Le%20Marchant.jpg", "http://www.numismondo.net/pm/nfl/nfl_Gov_John_Cavensidh_Boyle.jpg", "http://www.numismondo.net/pm/nfl/nfl_Gov_Sir_Wm_MacGregor.jpg", "http://www.numismondo.net/pm/nfl/nfl_gov_Sir%20Charles%20Alexander%20Harris.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.S109aCH.18514011Pound4Dollars1.3.1882_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.S109aCH.18514011Pound4Dollars1.3.1882r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S11223.1.1888_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S11223.1.1888r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.S1145Dollars3.1.1888_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.S1145Dollars3.1.1888r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S115aCH.1105031010Dollars3.1.1888No.3082_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S115aCH.1105031010Dollars3.1.1888No.3082r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S11620Dollars3.1.1888_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S11620Dollars3.1.1888r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.S124FPCH75016022Dollars1.5.1882_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.S124FPCH75016022Dollars1.5.1882r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S127201.5.1889_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.S127201.5.1889r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.A3r1Poundx18xx_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.A8S51903_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.A1050Cents191215_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.A1050Cents191215r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.A14d12.1.1920CL1_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_nflP.A14d12.1.1920CL1r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.A15a2Dollars2.1.1920_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.A15a2Dollars2.1.1920r_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.UNLSB4402b6DollarsRedeemed10.2.1953_jpg.jpg", "http://www.numismondo.net/pm/nfl/tn_NflP.UNLSB4402b6DollarsRedeemed10.2.1953r_jpg.jpg", "http://www.numismondo.net/gse1999-2016.png" ]
[]
[]
[ "GOVERNMENT OF NEWFOUNDLAND Paper Money 1901-20", "world paper money picture catalog", "money", "banknotes", "paper money", "IBNS", "International Bank Note Society", "collectible", "numismatics", "paper ephemera", "collecting", "world numismatics", "world papermoney", "Garry Saint Esq", "Garry Saint" ]
null
[ "Garry Saint" ]
null
GOVERNMENT OF NEWFOUNDLAND Paper Money, 1901-20
http://www.numismondo.net/pm/nfl/nfl_favicon.ico
null
Currency History: GBR until 1858; NFL 1850 - 1949; CAN 1949 > The first banknote attritutable to NFL was issued as P.A3 1 Pound 1850 Newfoundland became a Province of Canada 1.4.1949
9201
dbpedia
2
3
https://www.bankofcanadamuseum.ca/2024/03/welcoming-newfoundland-to-canada/
en
Welcoming Newfoundland to Canada
https://www.bankofcanada…egaMenu_NFLD.jpg
https://www.bankofcanada…egaMenu_NFLD.jpg
[ "https://www.bankofcanadamuseum.ca/wp-content/uploads/2021/06/RS700_117-Perkins-Will-Bank-of-Canada-Exteriors-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2014/07/img_about-boc_00-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2014/07/img_contact-us_EN_01-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2017/06/yourVisit-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2023/05/POST-Callouts_10-Questions_EN.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2014/07/img_contact-us_EN_01-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2014/06/img_exhibition-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2014/06/carousel-collection_02-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/06/MegaMenu_FREERIDE-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2014/08/img_journals-research-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2021/05/All-about-money_Feature-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/06/Mega-Menu-693x348-1-500x250.png", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-01-Nfld-Placentia.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-02-Nfld-promissary.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-03-Nfld-treasury-note.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-04-Nfld-pattern-and-coin.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-05-Nfld-gold-coin.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-06-Nfld-pblc-works.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-07-Nfld-mine.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-08-Nfld-Commercial-Bank.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-09-Nfld-Union-Bank.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-10-Nfld-signing.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-11-Nfld-Matthew-350x339-1.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-12-Nfld-last-cent.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-13-Nfld-last-5-cents.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2024/03/230-14-Nfld-last-10-cents.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2023/11/Aquisitions2023_MegaMenu-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2023/09/MegaMenu_ChequesMoney_Orders-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/uploads/2023/01/MegaMenu_Blog-217-500x250.jpg", "https://www.bankofcanadamuseum.ca/wp-content/themes/museum-build/img/boc-logo-en.png" ]
[]
[]
[ "" ]
null
[]
2024-03-25T00:00:00
Newfoundland’s entry into Confederation marked the end of an era when Canadian provinces issued their own coins and paper money.
en
https://www.bankofcanada…h-icon-57x57.png
https://www.bankofcanadamuseum.ca/2024/03/welcoming-newfoundland-to-canada/
How Newfoundland lost its money by joining Confederation The last vestiges of Newfoundland’s currency disappeared with the signing of the Terms of Union. Newfoundland’s entry into Confederation marked the end of an era when colonies issued their own coins and paper money. Newfoundland: island of cod When John Cabot landed at Bonavista in 1497, he claimed the island for King Henry VII of England, who called it the “New Found Launde.” It is ironic that for centuries Newfoundland (and today, Labrador) was remembered less for the "land” than for the seas and their abundance of cod fish beyond her shores. In fact, some early 16th century Portuguese maps called it terra do Bacalhau or ilha do Bacalhau, “land” or “island of cod.” Given that cod would drive the colony’s economy for the next four hundred years, maybe the Portuguese name would have been more suitable. Several Indigenous Peoples in North America—including Inuit, Innu, Wolastoqiyik, Mi'kmaq and Beothuk—have fished the Atlantic cod for thousands of years. What we call Newfoundland today was known as Ktaqmkuk when Europeans first landed on the island. It was inhabited by the Beothuk and Mi’kmaq at that time. Newfoundland became the site of an international fishery. Portuguese, Spanish, Basque, French, English and Dutch fishermen were active on the Grand Banks. Boats from ports all over Europe would cross the Atlantic Ocean in the spring, crowd the waters off the coast to cast their nets, and set up temporary camps on the shores to dry their catch. They had little interest in the island or the people that called it their home. For them, it was all about the fish! Permanent settlement, fish currency and coinage For nearly 200 years after Cabot’s landing, Newfoundland remained largely uninhabited by Europeans. In 1610, a few English fishers wintered at Cupids, located in the Avalon peninsula. After a couple of years, the population at the site was 62 people, including a few families. A decade later, in 1623, England chartered the colony of Avalon, with Ferryland as its main settlement. It was founded mainly to support the fishery. The French gained residence in Placentia (a variation of Plaisance), located on the other side of the peninsula, in 1655. The coexistence between English and French settlers during those years was tense and even violent. One campaign, launched by French forces, began in 1696 with the raiding of the Ferryland settlement. The campaign destroyed 23 English settlements along the coast of the Avalon Peninsula in the span of three months. Following this destruction, England passed new legislation in 1699 allowing permanent English settlement in Newfoundland to protect its fishing interests against any French aggression. The Treaty of Utrecht in 1713 permanently ceded Newfoundland to Great Britain, although the French maintained special fishing privileges with a base on the islands of St. Pierre and Miquelon. Despite the British government effectively discouraging settlement, Newfoundland had a population of about 2,000 settlers by 1700. The arrival of European settlers introduced diseases such as tuberculosis, which took an enormous toll on the Beothuk. A lack of both resources and outside help to confront the disease led to a decline in their numbers throughout the 18th and 19th centuries, until the Beothuk eventually disappeared. Coinage was scarce in Newfoundland, a phenomenon not uncommon in many English colonies around the world. For decades, commerce on the island operated on a credit system, with dried cod as the local trade commodity. In the spring, merchants on the island would outfit the fishermen with equipment, and the fishermen would settle their account in the fall with their seasonal catch. Merchants exported the salted and dried cod to Europe, South America and the Caribbean. Reliance on a credit system and the extensive use of bills of exchange to settle transactions between the island merchants and their suppliers in Europe further prove the lack of coinage. Coins were not available in any reliable quantity for commerce, let alone for capital to help grow the economy. Financial panic and the fall of the Newfoundland banks Newfoundland’s two banks, the Commercial and the Union, were the main providers of capital and currency for the colony. Yet by 1894, with a drying up of the cod fishery, difficulty in increasing mining output and rising costs to build the railway, the banks’ finances were stretched thin. They were overdrawn on their loans and riding the edge of insolvency. Acting on these rumours, people quickly sought to withdraw their money from the banks, only to learn that there were no funds to do so. Unable to meet their financial obligations, both banks permanently closed on December 10, 1894. The effects were immediate with businesses failing, workers losing their jobs and the price of food and other essentials rising. The entire colony was on the verge of bankruptcy. Payment of specie was suspended until Newfoundland passed legislation to wind up the affairs of the failed banks and for others, namely, the Bank of Montreal, the Bank of Nova Scotia and the Merchant’s Bank of Halifax (later, the Royal Bank of Canada), to come to the rescue. Notes of the Commercial and Union were redeemed at huge discounts. The inhabitants of Newfoundland who had faith in the banks to protect their savings lost almost everything. The 20th century and a new attitude toward Confederation Newfoundland never fully recovered from the 1894 financial crisis. And over the decades that followed, the option of joining Confederation seemed more and more attractive. The problem was that the rest of the Dominion of Canada was less enthusiastic about accepting it and its economic troubles. Throughout the First World War and the Great Depression, Newfoundland’s financial situation was desperate—so much so that, in 1934, the British parliament suspended the Newfoundland government and appointed a commission of government in hopes of steering the colony toward recovery. The Second World War turned around the colony’s fortunes, with increased immigration and influxes of money for the war effort. Newfoundland was again on the road to economic and financial stability, right in time for talks on joining Confederation to resurface. 1949: Newfoundland finally joins Canada In December 1945, the British parliament announced that Newfoundland would hold a National Convention to choose the colony’s political destiny: self-government or union with Canada. The factions were equally split, but the pro-Confederation delegates led by Joey Smallwood won the motion to go to Ottawa to discuss terms for joining with Canada. While several delegates of the National Convention rejected the draft terms, disagreeing over the style of government, active campaigning in favour of Confederation allowed for the option to remain on the referendum ballot. On June 3, 1948, Newfoundlanders went to the polls. In a low turnout, the votes were split, with no clear winner. The results of a second referendum held the following month gave Confederation the nod. The final Terms of Union were signed on December 11, 1948, and in February 1949, the Canadian Parliament ratified them. Newfoundland was in. Labrador was physically separated, but had always been a part of Newfoundland. To reflect this, the province changed its official name in 2001 to Newfoundland and Labrador, recognizing it as a single entity.
9201
dbpedia
0
11
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
en
Dominion of Newfoundland
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
[ "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/30?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/30?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/30?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/125?cb=20110304131402", "https://static.wikia.nocookie.net/formercountries/images/f/f5/Coat_of_Arms_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/105?cb=20110304131409", "https://static.wikia.nocookie.net/formercountries/images/f/fc/Map_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/250?cb=20110304131419", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/22?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/1/14/Red_Ensign_of_Great_Britain.svg/revision/latest/scale-to-width-down/22?cb=20110304134032", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/a/a4/Flag_of_the_United_States.svg/revision/latest/scale-to-width-down/22?cb=20110228004306", "https://static.wikia.nocookie.net/6a181c72-e8bf-419b-b4db-18fd56a0eb60", "https://static.wikia.nocookie.net/6c42ce6a-b205-41f5-82c6-5011721932e7", "https://static.wikia.nocookie.net/464fc70a-5090-490b-b47e-0759e89c263f", "https://static.wikia.nocookie.net/f7bb9d33-4f9a-4faa-88fe-2a0bd8138668" ]
[]
[]
[ "" ]
null
[ "Contributors to The Countries Wiki" ]
null
The Dominion of Newfoundland was a dominion of the United Kingdom in North America.  Canada (Commonwealth realm)  British America (1607-1783)  United Kingdom: British North America (1783-1907)  Canada (From 1867)  United States World Statesmen.org Wikisource 1911 encyclopedia project Wikipedia
en
/skins-ucp/mw139/common/favicon.ico
The Countries Wiki
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
Dominion of the ‌United Kingdom ← 1907–1949 → → Motto Quaerite Prime Regnum Dei Seek ye first the kingdom of God Anthem Ode to Newfoundland Capital St. John's Status Dominion Legislature House of Assembly History - Dominion - Newfoundland Act Currency Newfoundland dollar British North America Canada Newfoundland v The Dominion of Newfoundland was a dominion of the United Kingdom in North America. Nation Canada (Commonwealth realm) Canadian Polities British America (1607-1783) United Kingdom: British North America (1783-1907) Canada (From 1867) Neighbouring Nations United States References
9201
dbpedia
3
52
https://www.alternatehistory.com/forum/threads/britain-retains-newfoundland.524396/
en
Britain retains Newfoundland
[ "https://www.alternatehistory.com/forum/styles/default/xenforo/xenforo-logo.png", "https://www.alternatehistory.com/forum/data/avatars/m/3/3429.jpg?1596814218", "https://www.alternatehistory.com/forum/data/avatars/m/146/146825.jpg?1646357320", "https://www.alternatehistory.com/forum/data/avatars/m/10/10760.jpg?1492342824", "https://www.alternatehistory.com/forum/data/avatars/m/3/3429.jpg?1596814218", "https://www.alternatehistory.com/forum/data/avatars/m/3/3429.jpg?1596814218", "https://www.alternatehistory.com/forum/data/avatars/m/124/124902.jpg?1662519203", "https://www.alternatehistory.com/forum/data/avatars/m/3/3429.jpg?1596814218" ]
[ "https://www.youtube.com/embed/Sypa5U-FbKY?wmode=opaque" ]
[]
[ "" ]
null
[ "Reflection" ]
2022-02-14T15:17:54+00:00
Is it feasible for the island of Newfoundland off of Canada's coast to remain British, and not be incorporated into Canada (as part of Newfoundland and...
en
alternatehistory.com
https://www.alternatehistory.com/forum/threads/britain-retains-newfoundland.524396/
Is it feasible for the island of Newfoundland off of Canada's coast to remain British, and not be incorporated into Canada (as part of Newfoundland and Labrador)? I feel like the UK would've liked to have retained an American exclave even in the process of decolonization, due to the advantages it brings in resources, extending the reach of Britain's military, and personal prestige given Newfoundland's historical importance. I'll admit that a part of me kind of likes the idea of having a slice of Britain in North America, off of Canada's coast and in relatively close proximity to the United States, kinda like having a slice of France in South America bordering Brazil. So I'd figure to ask here. How likely would it be for Newfoundland to be a full possession of Britain to this day, rather than a part of Canada, and what might that have entailed? The British were the ones desperately trying to force Newfoundland, which they didn't want, into Canada all through the '30s and '40s. If they wanted to keep it there's no reason why they couldn't- the Dominion of Newfoundland had gone bankrupt and been returned to the Crown in 1934, so the referendum to unify with Canada required British permission (which, to be clear, was immediately forthcoming because Britain viewed Newfoundland as undesirable real estate). So the only change required is that sometime between 1945 and 1949 Britain has to decide it wants to keep the colony (1948 really- the technical end date is 1949, but by that point the referendum is already planned, rigged, and going ahead). The major question is why. Military bases? The US alliance already exists and gets them better basing options cheaper. Natural resources? The big hydroelectric dams haven't been built and the offshore oil fields are decades away from becoming cost-effective to exploit. The prestige of Empire? Post-war the British are running away from that narrative with all possible speed. All that said, a different WW2 and more fraught relationships between the US and UK could certainly have led to Britain retaining Newfoundland longer, becoming effectively a bigger St. Pierre and Miquelon or a smaller Greenland- a European-owned island off the coast of North America that lacks anything valuable enough for the US to care. If only there was a timeline on the subject. Will eventually get back to it at some point ( - RL has been giving me some benders, although I'm now planning on graduating as an Honors student with an Associate degree so at least I'm getting some positive stuff going, plus now the original thread is locked). At the same time, I've also been giving it a bit of a rethink, and am thinking of going in either one (or both - saves me from having to duplicate everything) of two directions: 1) a divided Britain (I'm temporarily calling it a "three Britains" scenario) where Britain and Germany (if it gets its act together early on) switch places in terms of 20th century history. The details would be radically different and more drawing on pre-existing stuff in Britain, but that throws Newfoundland out of whack, although *not* strictly speaking a Taiwan analogue (the British government would probably rather decamp in both Ottawa and Victoria, BC - the latter because of Hatley Castle - while Montréal, downriver from Ottawa, would be the new economic center); 2) alternately - well, let's just say this US Marine Band version of the Overture to People's Artist of the USSR D.D. Shostakovich's score to Ovod (The Gadfly), the 1950s film version of the Russian translation of Ethel Voynich's novel, is starting to grow on me: Which points towards another direction, that of a Soviet Britain (that is, a Communist Britain that joins the Soviet Union, and goes through the ups and downs with a particular British twist, and eventually follows a similar course that the Baltics took towards independence - but with some veneer of legality by also playing by the rules). A good portion of the details, outside of a possible "cookie-cutter" approach, are pretty hazy (including the specifics of how Britain ends up as a socialist state in the first place, as well as accounting for a WW2 analog), but there are some bits that I do know I want to try. Again, Newfoundland is the odd one out, but it does allow not only for an Imperial Federation (of the Dominions and the UK-in-Exile) to occur, but the government-in-exile would now have a vested interest in this Appalachian outcrop masquerading as an island (and there's much that needs to change in Newfoundland, anyway!) since it's now the last resort option. All in all, regardless of which path I choose, it would basically be another case of Be Careful What You Wish For. Would a Canada that’s more obsessively wedded to the National Policy work? Protectionism walloped the Maritimes and a Newfoundland that watches that persist may go the other way in a referendum Not quite - Canada was very much obsessively wedded to the National Policy during all the time Newfoundland was a Dominion and prior, and that didn't change the equation one bit (indeed, after a disastrous banking crisis in the 1890s, IIRC, Newfoundland was forced to adopt the Canadian dollar as its own currency). What probably saved Newfoundland, sadly enough, was sectarian tensions - Canada was originally seen negatively by the local Orangemen as a Papist plot because of Quebec (as I previously mentioned), but when Confederation happened the tables were turned (indeed, if one looks carefully at the 1948 referendum results, there's something that looks like no mere coincidence as to which regions supported a return to Dominion status or Confederation). Now, had the center of political, economic, cultural, etc. life in Newfoundland been on the other side of the island, things would have been rather different and would definitely jump at the first opportunity to become a province - but that's a pre-1900 POD. Not exactly. Britain was attempting to keep some level of it's power and prestige as an empire after the Cold War (much like the other colonial powers). This of course led to the incident known as the Suez Crisis, a great humiliation for both Britain and France when it became clear that their best days were behind them and were superseded by the USA and USSR. The economics of fishing are the major reason why France kept St. Pierre and Miquelon, so don't discount that option! More generally, the possibility that Britain would want to keep Newfoundland for some idiosyncratic reason if there was a valuable resource, or particularly resonant bit of history that would make the island stand out among the colonial possessions Britain was giving up at the time shouldn't be discounted- but any TL would need to figure out what specific motivating factor made them want to keep Newfoundland specifically (or look at the consequences of Britain trying to hold more of her imperial possession together in the late '40s).
9201
dbpedia
0
0
https://en.wikipedia.org/wiki/Coins_of_the_Newfoundland_dollar
en
Coins of the Newfoundland dollar
https://en.wikipedia.org/static/favicon/wikipedia.ico
https://en.wikipedia.org/static/favicon/wikipedia.ico
[ "https://en.wikipedia.org/static/images/icons/wikipedia.png", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-wordmark-en.svg", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-tagline-en.svg", "https://upload.wikimedia.org/wikipedia/commons/thumb/d/d9/Canada_Newfoundland_Rutherford_Penny_Token_c1840.jpg/220px-Canada_Newfoundland_Rutherford_Penny_Token_c1840.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/4/41/Canada_Newfoundland_Victoria_1_Cent_1885.jpg/250px-Canada_Newfoundland_Victoria_1_Cent_1885.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/a/a9/Canada_Newfoundland_Victoria_5_Cents_1870_%28Obverse_1%29.jpg/250px-Canada_Newfoundland_Victoria_5_Cents_1870_%28Obverse_1%29.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/8/8b/Canada_Newfoundland_Victoria_10_Cents_1894.jpg/250px-Canada_Newfoundland_Victoria_10_Cents_1894.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/3/3f/Canada_Newfoundland_Victoria_20_Cents_1894_%28Obverse_2%29.jpg/250px-Canada_Newfoundland_Victoria_20_Cents_1894_%28Obverse_2%29.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/8/84/Canada_Newfoundland_Victoria_50_Cents_1882H.jpg/250px-Canada_Newfoundland_Victoria_50_Cents_1882H.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/e/e2/Canada_Newfoundland_Victoria_gold_2_Dollars_1870.jpg/250px-Canada_Newfoundland_Victoria_gold_2_Dollars_1870.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/f/ff/Canada_Newfoundland_Edward_VII_1_Cent_1904H.jpg/250px-Canada_Newfoundland_Edward_VII_1_Cent_1904H.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/0/0f/Canada_Newfoundland_Edward_VII_5_Cents_1903.jpg/250px-Canada_Newfoundland_Edward_VII_5_Cents_1903.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/b/bf/Canada_Newfoundland_Edward_VII_10_Cents_1904H.jpg/250px-Canada_Newfoundland_Edward_VII_10_Cents_1904H.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/e/e2/Canada_Newfoundland_Edward_VII_20_Cents_1904H.jpg/250px-Canada_Newfoundland_Edward_VII_20_Cents_1904H.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/f/f7/Canada_Newfoundland_Edward_VII_50_Cents_1908.jpg/250px-Canada_Newfoundland_Edward_VII_50_Cents_1908.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/54/Canada_Newfoundland_George_V_1_Cent_1936.jpg/250px-Canada_Newfoundland_George_V_1_Cent_1936.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/e/e4/Canada_Newfoundland_George_V_5_Cents_1912.jpg/250px-Canada_Newfoundland_George_V_5_Cents_1912.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/5a/Canada_Newfoundland_George_V_10_Cents_1912.jpg/250px-Canada_Newfoundland_George_V_10_Cents_1912.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/c/c8/Canada_Newfoundland_George_V_20_Cents_1912.jpg/250px-Canada_Newfoundland_George_V_20_Cents_1912.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/1/14/Canada_Newfoundland_George_V_25_Cents_1917C.jpg/250px-Canada_Newfoundland_George_V_25_Cents_1917C.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/b/bf/Canada_Newfoundland_George_V_50_Cents_1917C.jpg/250px-Canada_Newfoundland_George_V_50_Cents_1917C.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/69/Canada_Newfoundland_George_VI_1_Cent_1942.jpg/250px-Canada_Newfoundland_George_VI_1_Cent_1942.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/f/fe/Canada_Newfoundland_George_VI_5_Cents_1941C.jpg/250px-Canada_Newfoundland_George_VI_5_Cents_1941C.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/c/c2/Canada_Newfoundland_George_VI_10_Cents_1941C.jpg/250px-Canada_Newfoundland_George_VI_10_Cents_1941C.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/2/28/British_Empire_1897.jpg/32px-British_Empire_1897.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/f/fc/Maple_Leaf_%28from_roundel%29.svg/25px-Maple_Leaf_%28from_roundel%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/55/Bills_and_coins.svg/32px-Bills_and_coins.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/4/46/United_States_penny%2C_obverse%2C_2002.png/28px-United_States_penny%2C_obverse%2C_2002.png", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://en.wikipedia.org/static/images/footer/wikimedia-button.svg", "https://en.wikipedia.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[ "Contributors to Wikimedia projects" ]
2005-12-01T02:32:20+00:00
en
/static/apple-touch/wikipedia.png
https://en.wikipedia.org/wiki/Coins_of_the_Newfoundland_dollar
See also: Newfoundland dollar Newfoundland, as a separate British colony, produced its own decimal currency between 1865 and 1947. The Coins of Newfoundland are of historical importance as Newfoundland was a British colony until 1907, and a Dominion until 1949, when Newfoundland and Labrador became the tenth province of Canada. Traders' tokens [edit] Rutherford brothers [edit] The first Newfoundland traders' tokens were Halfpenny tokens issued by brothers Robert & I.S. Rutherford in St John's in 1840–41.[1] There are two varieties of the tokens – a dated type and an undated type. In 1846, after a fire destroyed the St. John's store, two additional Rutherford Brothers (George and Andrew) opened a new store in Harbour Grace and issued a second set of tokens, inscribed RUTHERFORD BROS.[1] These pieces were minted by Ralph Heaton & Sons of Birmingham, England (commonly known as Heaton's Mint).[1] These pieces are unique in one respect – they have the 'RH' mintmark above the date. The Peter M'Auslane farthing [edit] Another early Newfoundland traders' token was issued in the 1840s by Peter M'Auslane, a general merchant in St John's.[2] Following the same 1846 St. John's fire which destroyed his business, he left Newfoundland and settled in Upper Canada (now Ontario). The obverse of this very rare piece is inscribed 'PETER M'AUSLANE St. JOHNS NEWFOUNDLAND', and the reverse is inscribed 'SELLS ALL SORTS OF SHOP & STORE GOODS'. Anonymous issues [edit] These pieces do not bear either an issuer's name or a place name. There were two issues of these pieces: a Halfpenny dated 1858 and a Halfpenny dated 1860.[2] The 1858 Halfpenny token, which is very rare, has a ship on the obverse similar to the Ship Halfpenny tokens from Prince Edward Island. The date 1858 alone appears across the centre of the reverse. The 1860 Halfpenny token, which is scarce has the date 1860 in the centre of the obverse inside a circle. The inscription FISHERY RIGHTS FOR NEWFOUNDLAND is enclosed outside the inner circle. The reverse of this piece is inscribed RESPONSIBLE GOVERNMENT going around the outside and AND FREE TRADE is in the centre of the reverse. This piece makes a political statement on promoting the fishing industry and asserting a claim to responsible government. Newfoundland dollar coinage (1865–1947) [edit] In 1865, Newfoundland changed over to decimal currency following the footsteps of Canada, New Brunswick, and Nova Scotia. Pattern coins were issued in 1864, as were specimen cents. Newfoundland was the only British North American colony to have its own gold coin (though the Ottawa mint also produced gold sovereigns). Originally, a gold dollar was considered, but it was decided it might be lost by the fishermen due to its small size. Thus, a two-dollar denomination was chosen for the gold coin.[3] Three (equivalent) denominations were indicated on the coin, as it was denominated as $2, 200 cents, and 100 pence (equivalent value in sterling). One thing that differentiates the later versions of the dollar coins is that they feature the crowned Percy Metcalfe effigy of King George VI. Usually, this portrait is used for Crown colonies such as Hong Kong, Malaya, or India, whereas for normal Canadian coins, an uncrowned effigy of the King by Thomas Humphrey Paget is used. Complete type set of Newfoundland dollar coinage [edit] Coins of the Newfoundland dollar Monarch Value Obverse/Reverse Issue date[nb 1] Design Victoria 001 1865, 1872(H) 1873, 1876(H) 1880, 1885 1888, 1890 1894, 1896 Horace Morehen (des) Thomas Minton (eng)[7] 005 1865, 1870 1872(H), 1873[nb 2] 1876(H), 1880–81 1882(H), 1885 1888, 1890 1894, 1896 Leonard Charles Wyon[8] 010 1865, 1870 1872(H), 1873 1876(H), 1880 1882(H), 1885 1888, 1890 1894, 1896 Leonard Charles Wyon[9][nb 3] 020 1865, 1870 1872(H), 1873 1876(H), 1880–81 1882(H), 1885 1888, 1890 1894, 1896 1899, 1900 Leonard Charles Wyon[10] and Horace Morehen[11] 050 1870, 1872(H) 1873–74, 1876(H) 1880–81, 1882(H) 1885, 1888 1894, 1896 1898–1900 Leonard Charles Wyon[12] 200 1865, 1870 1872, 1880–81[nb 4] 1882(H), 1885 1888 Leonard Charles Wyon[14] Edward VII 001 1904(H) 1907 1909 George William de Saulles (obv) Horace Morehen (rev) 005 1903 1904(H) 1908 George William de Saulles[16] 010 1903 1904(H) George William de Saulles[17] 020 1904(H) George William de Saulles (obv)[18] W.H.J. Blakemore(rev) 050 1904(H) 1907–09 George William de Saulles (obv)[20] W.H.J. Blakemore (rev) George V 001 1913 1917(C) 1919–20(C) 1929 1936 Edgar Bertram MacKennal (obv) Horace Morehen (rev) 005 1912 1917(C) 1919(C) 1929 Edgar Bertram MacKennal (obv) George William de Saulles (rev) 010 1912 1917(C) 1919(C) Edgar Bertram MacKennal (obv) George William de Saulles (rev) 020 1912 Edgar Bertram MacKennal (obv) W.H.J. Blakemore (rev) 025 1917(C) 1919(C) Edgar Bertram MacKennal (obv) W.H.J. Blakemore (rev) 050 1911 1917–19(C) Edgar Bertram MacKennal (obv) W.H.J. Blakemore (rev) George VI 001 1938, 1940 1941(C), 1942 1943–44(C) 1947(C) Percy Metcalfe (obv) Walter J. Newman (rev) 005 1938, 1940–43(C) 1944–47(C)[nb 5] Percy Metcalfe (obv) George William de Saulles (rev) 010 1938, 1940 1941–44(C) 1945–47(C)[nb 6][nb 7] Percy Metcalfe (obv) George William de Saulles (rev) References [edit] British Empire portal Canada portal Money portal Numismatics portal Notes [edit]
9201
dbpedia
0
93
https://bnaps.org/studygroups/Newfoundland/newfie_intro.htm
en
Nfld Philately 1
https://bnaps.org/images/bnaps.ico
https://bnaps.org/images/bnaps.ico
[ "https://bnaps.org/studygroups/Newfoundland/images/Image0-Map.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1a-1-2cDog.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1b-2cFishOrange.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1c-2cFishGreen.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image1d-5cSeal.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image2-StudyGroupMeeting.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image3-FirstIssue.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image4-1861Cover.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image5-CentsCoverAnimals.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image6-1897-1cQV-Green.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image7-1897-1cOverprintStrip.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image8-1897RoyalFamilyProofs.jpg", "https://bnaps.org/studygroups/Newfoundland/images/Image9-1879Postcard.jpg" ]
[]
[]
[ "" ]
null
[]
null
en
https://bnaps.org/images/bnaps.ico
null
Newfoundland Philately BNAPS Newfoundland Study Group Page 1 of 2 Introduction "Newfoundland was a self-governing Dominion of the British Empire from 1855-1933, when it became a Crown Colony. In 1949 it united with Canada". - Scott Classic Stamp Catalogue, 2002 Newfoundland and Labrador are one province of Canada. Formal mail service to and from the lightly populated Labrador began in 1863 when Newfoundland let the first mail contract. Its permanent population was only 6,000 in 1949 when Newfoundland and Labrador became the 10th province of Canada. There have always been a lot more people during summer fishing season, of course. We'll see an example of a cover from Labrador in the 20th century part of this survey. Newfoundland issued almost 300 postage stamps while a Dominion and Crown Colony, about 30 pieces of postal stationery and many revenue stamps. Because of that, it provides collecting opportunities for general collectors as well as material for specialists or topical collectors. It attracts those who collect definitive or commemorative stamps, air mail stamps, postal stationery, postage dues, revenues, varieties, postal history/rates as well as those just fond of stamps from the earlier years of philately (up to 1949) before modern emanations from many countries started to inundate and discourage collectors. In the 20th century alone it issued about 200 commemorative, definitive and postage due stamps with no "wallet-busters" in that group and completion is not difficult. For the more ambitious, the air mails provide a challenge requiring more effort (and money!). Many of us - especially those who started collecting stamps as kids - can still recall our introduction to the beautiful animal stamps from Newfoundland that could be bought for pennies - the green or orange codfish, the many stamps featuring the Newfoundland dogs, blue harp seals, etc. These are fond memories that cannot be undone, and often are enough to trigger a return to philately as an adult with enough leisure time finally to spend on a hobby. These animal stamps may bring back memories of your youth. The Newfoundland Study Group In 1985, 14 dedicated philatelists formed the Newfoundland Study Group, with Clarence A. Stillions elected Chairman and editor of the Newfie Newsletter. The newsletter has come out on a regular basis ever since with over 150 issues through 2015. Editions since 2003 have included some color pages. It won the John S. Siverts Award in 2004, 2010, and 2012 for best BNAPS Study Group newsletter. Today the Study Group has over 75 members from around the world. Some members are undertaking research to enhance our knowledge of Newfoundland philately or exhibit Newfoundland stamps. Others collect stamps, or postal stationery, or varieties, or just consider themselves Newfoundland generalists. To become a member of the Study Group, one must first join BNAPS. Sammy Whaley addresses the Study Group at BNAPEX 2004 in Baltimore, MD. A Survey of Newfoundland Philately This section includes examples of the varied stamps and postal stationery of Newfoundland and reflects some areas of collecting interest of our group members. The 19th Century Newfoundland's first issue was on January 1, 1857. The 1d (or "one penny") had a central motif of the Royal Crown in profile. The stamps were recess-printed by Perkins, Bacon & Company. The 1d was imperforate and issued in sheets of 120 (12 x 10). Newfoundland's first stamp Several of our members exhibit and write extensively on the 19th century postal history of this country. The cover that follows is a very rare one from 1861 with a bisected 8d (8 pence) stamp along with a 3d (3 pence) triangle. The cover was sent from Harbour Britain to North Oxford, Mass. Take a look at the cover and then we'll explain the rate. A rare letter from 1861. Group member expert Colin Lewis explains the rate: "There were two forms of currency as legal tender in Newfoundland during this period. There was British Sterling currency and Newfoundland domestic currency. They were inter-changeable but not valued at par... To understand this cover's rate, you must know that the bisected 8 pence stamp is a Sterling value, and as such is worth 4 pence Sterling. The 3 pence triangular stamp is valued in Newfoundland currency and had a primary use of paying domestic covers up to ½ ounce. This stamp had a convertible Sterling value of 2 ½ pence. Mail sent to the U.S. had to be paid in Sterling. The rate from St. John's to Boston was 4 pence Sterling per ½ ounce but this cover was from an out-port that also required 3 pence Newfoundland currency per ½ ounce. The actual rate from such an out-port to the U.S. was 6 ½ pence Sterling. Had a 6 ½ pence stamp been available, no doubt it would have been affixed. The cover went from St. John's by steamer to Halifax, Nova Scotia, where it was carried aboard the Cunard 'Europa' to Boston". Under "An Act to Regulate The Island Post of this Colony" of April 1865, the first of the country's decimal currency stamps were issued. All stamps issued thenceforth would be in cents and dollars. Most of the remaining 19th century stamps would be printed by the American Bank Note Company of New York. The next cover shows the early images of animals used by Newfoundland - a codfish and a harp seal. Note that it also includes an example of beautiful handwriting. An 1872 cover shows cents issues, featuring animals. According to our cents-issue expert, Sammy Whaley, this cover probably originated in St. Pierre and Miquelon, but has only a St. John's date stamp. It was sent on April 1, 1872, to Harbour Grace. The fancy handwriting was by Horatio John Watts and part of a well-known correspondence to Claudius Watts. It overpaid the six-cent double inland rate by one cent. In 1897, Newfoundland decided to issue a 14-stamp set honoring John Cabot who discovered the island 400 years previously. Catering to stamp-collector interests, it hoped to duplicate the interest created by the 1893 Columbian issue of the United States. Colonial Secretary Robert Bond ordered the withdrawal of existing stamps, and the plates for this issue were destroyed shortly after its June release. The stamps were printed by the American Bank Note Company in sheets of 100 (10 x 10). The one-cent stamps showed a contemporary photograph of Queen Victoria by Bassano of London. 1897 was also the diamond jubilee of the Queen. The one-cent stamp proved too popular and was exhausted by late September, 1897. With the plates destroyed, the Post Office had a problem. One-cent stamps were needed for local covers, third-class mail and circulars, among other things. The one-cent Queen Victoria stamp of the 1897 John Cabot set. The one-cent shortage forced Newfoundland to issue its first provisionals - a one-cent surcharge on the 1890 three-cent Queen Victoria stamp. It was printed locally in St. John's. The printer used different fonts in the setting of fifty resulting in varieties that generated a lot of collector interest. There were three distinct fonts, now listed separately in catalogues. Although 40,000 stamps were surcharged, they sold quickly. From that point forward, hoards of collectors would scoop up all subsequent provisionals, hoping to discover scarce varieties. Used examples of scarcer varieties of the 1897 provisionals. This used strip is from positions 47-49 in the setting of 50. The font on the rightmost stamp is sans serif. Only two of the 50 stamps (positions 49-50) were of this rare type. A new red one-cent stamp with Queen Victoria came out on December 4, 1897, ending the shortage. The new permanent set featured portraits of the Royal Family including the first ever of Prince Edward, the future Duke of Windsor, as a baby. The stamps were issued between 1897-1901. Below we see proof pairs. Some of our members collect proofs, imperforates and specimens. Proof pairs of the 1897-1901 Royal Family set. Our quick survey of the 19th century would not be complete without an example of postal stationery. Here we see a unique example of the two-cent Queen Victoria postcard of 1879. Queen Victoria postcard of 1879. What makes this postcard unique? Our member, Rob Moore, collects Newfoundland postal stationery. He discovered this postcard, which was used on July 23, 1879. This has now been confirmed by BNA stationery experts Bill Walton and Robert Lemire as the earliest known use (EKU) of this card.
9201
dbpedia
2
65
https://stampaday.wordpress.com/2017/04/26/newfoundland-270-1947/
en
Newfoundland #270 (1947)
https://stampaday.wordpr…-1947.jpg?w=1200
https://stampaday.wordpr…-1947.jpg?w=1200
[ "https://stampaday.wordpress.com/wp-content/uploads/2019/11/0001tr.png?w=90", "https://stampaday.wordpress.com/wp-content/uploads/2019/08/cropped-img_4138-1.jpg", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/newfoundland-270-1947.jpg?w=1920&h=768&crop=1", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/newfoundland-270-1947.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/newfoundland-and-labrador-map-2.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/newfoundland-map-3.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/canada-282-1949.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/john-cabot.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/extralarge-hero.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/sam_9843.jpg?w=720", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/newfoundland-dominion-of-civil-ensign.png?w=300&h=150", "https://stampaday.wordpress.com/wp-content/uploads/2017/04/newfoundland-and-labrador-coa.png?w=136&h=150", "https://1.gravatar.com/avatar/7740f523ee01f8c4bf297d0ab76d98aa1c82ecf9e68e3095ec3e9d8acd7f08c5?s=20&d=identicon&r=G", "http://s05.flagcounter.com/countxl/lFj/bg_FFFFFF/txt_000000/border_CCCCCC/columns_2/maxflags_250/viewers_0/labels_1/pageviews_0/flags_0/percent_0/", "http://s09.flagcounter.com/count2_US/4ykv/bg_FFFFFF/txt_000000/border_CCCCCC/columns_2/maxflags_52/viewers_0/labels_1/pageviews_0/flags_0/percent_0/", "https://secure.gravatar.com/blavatar/adefba2e155966a57558f29c20c7be2f8186bff210bbcb14fbd9434994fa9edb?s=50&d=https%3A%2F%2Fs2.wp.com%2Fi%2Flogo%2Fwpcom-gray-white.png", "https://secure.gravatar.com/blavatar/adefba2e155966a57558f29c20c7be2f8186bff210bbcb14fbd9434994fa9edb?s=50&d=https%3A%2F%2Fs2.wp.com%2Fi%2Flogo%2Fwpcom-gray-white.png", "https://pixel.wp.com/b.gif?v=noscript" ]
[]
[]
[ "" ]
null
[ "Mark Joseph Jochim" ]
2017-04-26T00:00:00
Newfoundland was a British dominion from 1907 to 1949. It was situated in northeastern North America along the Atlantic coast and comprised the island of Newfoundland and Labrador on the continental mainland to the northwest, with a combined area of 157,500 square miles (405,212 square kilometers). The dominion's seat of government was the city of St.…
en
https://secure.gravatar.com/blavatar/adefba2e155966a57558f29c20c7be2f8186bff210bbcb14fbd9434994fa9edb?s=32
A Stamp A Day
https://stampaday.wordpress.com/2017/04/26/newfoundland-270-1947/
Newfoundland was a British dominion from 1907 to 1949. It was situated in northeastern North America along the Atlantic coast and comprised the island of Newfoundland and Labrador on the continental mainland to the northwest, with a combined area of 157,500 square miles (405,212 square kilometers). The dominion’s seat of government was the city of St. John’s. Before attaining dominion status, Newfoundland was a British colony, self-governing from 1855. Newfoundland was one of the original “dominions” within the meaning of the Statute of Westminster of 1931 and accordingly enjoyed a constitutional status equivalent to the other dominions at the time. The official name of the dominion was “Newfoundland” and not, as is sometimes reported, “Dominion of Newfoundland”. The Union Flag was adopted by the legislature as the official national flag of Newfoundland on May 15, 1931, before which time the Newfoundland Red Ensign, as civil ensign of Newfoundland, was used as the national flag (though not adopted by the legislature). In 1934, Newfoundland became the only dominion to give up its self-governing status, ending 79 years of self-government. On February 16, 1934, the UK government appointed six commissioners, three from Newfoundland and three from the UK, with the Governor as chairman. The system of a six-member Commission of Government continued to govern Newfoundland until it became the tenth province to enter the Canadian Confederation on March 31, 1949, as “Newfoundland.” On December 6, 2001, an amendment was made to the Constitution of Canada to change the province’s official name to Newfoundland and Labrador. With an area of 42,031 square miles (108,860 square kilometers), Newfoundland is the world’s 16th-largest island, Canada’s fourth-largest island, and the largest Canadian island outside the North. The capital, St. John’s, is located on the southeastern coast of the island; Cape Spear, just south of the capital, is the easternmost point of North America, excluding Greenland. It had 29 percent of the dominion’s land area. The island is separated from the Labrador Peninsula by the Strait of Belle Isle and from Cape Breton Island by the Cabot Strait. It blocks the mouth of the Saint Lawrence River, creating the Gulf of Saint Lawrence, the world’s largest estuary. Newfoundland’s nearest neighbor is the French overseas community of Saint-Pierre and Miquelon. Labrador occupies the eastern part of the Labrador Peninsula. It is bordered to the west and the south by the Canadian province of Quebec. The name “Newfoundland” is a translation of the Portuguese Terra Nova, that is also reflected in the French name for the Province’s island part (Terre-Neuve). The influence of early Portuguese exploration is also reflected in the name of Labrador, which derives from the surname of the Portuguese navigator João Fernandes Lavrador. Human habitation in Newfoundland and Labrador can be traced back about 9,000 years. The Maritime Archaic peoples were groups of Archaic cultures of sea-mammal hunters in the subarctic. They prospered along the Atlantic Coast of North America from about 7000 BC to 1500 BC. Their settlements included longhouses and boat-topped temporary or seasonal houses. They engaged in long-distance trade, using as currency white chert, a rock quarried from northern Labrador to Maine. The southern branch of these people was established on the north peninsula of Newfoundland by 5,000 years ago. The Maritime Archaic period is best known from a mortuary site in Newfoundland at Port au Choix. The Maritime Archaic peoples were gradually displaced by people of the Dorset Culture (Late Paleo-Eskimo) who also occupied Port au Choix. The number of their sites discovered on Newfoundland indicates they may have been the most numerous group of Aboriginal people to live there. They thrived from about 2000 BC to AD 800. Many of their sites were located on exposed headlands and outer islands. They were more oriented to the sea than earlier peoples, and had developed sleds and boats similar to kayaks. They burned seal blubber in soapstone lamps. Many of these sites, such as Port au Choix, recently excavated by Memorial archaeologist, Priscilla Renouf, are quite large and show evidence of a long-term commitment to place. Renouf has excavated huge amounts of harp seal bones at Port au Choix, indicating that this place was a prime location for the hunting of these animals. The people of the Dorset Culture (800 BC – AD 1500) were highly adapted to living in a very cold climate, and much of their food came from hunting sea mammals through holes in the ice. The massive decline in sea ice during the Medieval Warm Period would have had a devastating impact upon their way of life. The appearance of the Beothuk culture is believed to be the most recent cultural manifestation of peoples who first migrated from Labrador to Newfoundland around 1 AD. The Inuit, found mostly in Labrador, are the descendants of what anthropologists call the Thule people, who emerged from western Alaska around AD 1000 and spread eastwards across the High Arctic, reaching Labrador around 1300–1500. Researchers believe that the Dorset culture lacked the dogs, larger weapons and other technologies that gave the expanding Inuit people an advantage. Over time, groups started to focus on resources available to them locally. The inhabitants eventually organized themselves into small bands of a few families, grouped into larger tribes and chieftainships. The Innu are the inhabitants of an area they refer to as Nitassinan, i.e. most of what is now referred to as northeastern Quebec and Labrador. Their subsistence activities were historically centered on hunting and trapping caribou, deer and small game. Coastal clans also practiced agriculture, fished and managed maple sugar bush. The Innu engaged in tribal warfare along the coast of Labrador with the Inuit groups that had significant populations. The Mi’kmaq of southern Newfoundland spent most of their time on the shores harvesting seafood; during the winter they would move inland to the woods to hunt. Over time, the Mi’kmaq and Innu divided their lands into traditional “districts”. Each district was independently governed and had a district chief and a council. The council members were band chiefs, elders and other worthy community leaders. In addition to the district councils, the Mi’kmaq tribes also had a Grand Council or Santé Mawiómi, which according to oral tradition was formed before 1600. The oldest confirmed accounts of European contact date from a thousand years ago as described in the Viking (Norse) Icelandic Sagas. Around the year 1001, the sagas refer to Leif Ericson landing in three places to the west, the first two being Helluland (possibly Baffin Island) and Markland (possibly Labrador). Leif’s third landing was at a place he called Vinland (possibly Newfoundland). Archaeological evidence of a Norse settlement was found in L’Anse aux Meadows, Newfoundland, which was declared a World Heritage site by UNESCO in 1978. There are several other unconfirmed accounts of European discovery and exploration, one tale by men from the Channel Islands being blown off course in the late fifteenth century into a strange land full of fish, and another from Portuguese maps that depict the Terra do Bacalhau, or land of codfish, west of the Azores. The earliest, though, is the Voyage of Saint Brendan, the fantastical account of an Irish monk who made a sea voyage in the early sixth century. While the story itself became a part of myth and legend, some historians believe it is based on fact. The next European visitors to Newfoundland were Portuguese, Basque, Spanish, French and English migratory fishermen. In 1496, Genoese navigator John Cabot (Giovanni Caboto) obtained a charter from English King Henry VII to “sail to all parts, countries and seas of the East, the West and of the North, under our banner and ensign and to set up our banner on any new-found-land” and on June 24, 1497, landed in Cape Bonavista. Historians disagree on whether Cabot landed in Nova Scotia in 1497 or in Newfoundland, or possibly Maine, if he landed at all, but Bonavista is recognized by the governments of Canada and the United Kingdom as being Cabot’s “official” landing place. In 1499 and 1500, Portuguese mariners João Fernandes Lavrador and Pêro de Barcelos explored and mapped the coast the former’s name appearing as “Labrador” on topographical maps of the period. The Maggiolo’s World Map, 1511, shows a solid Eurasian continent running from Scandinavia around the North Pole, including Asia’s arctic coast, to Newfoundland-Labrador and Greenland. On the extreme northeast promontory of North America, Maggiolo place-names include Terra de los Ingres (Land of the English), and Terra de Lavorador de rey de portugall (Land of Lavrador of the King of Portugal). Further south, we notice Terra de corte reale de rey de portugall (Land of the Royal Court of the King of Portugal) and terra de pescaria (Fishing Land). Based on the Treaty of Tordesillas, the Portuguese Crown claimed it had territorial rights in the area visited by John Cabot in 1497 and 1498. Subsequently, in 1501 and 1502 the Corte-Real brothers, Miguel and Gaspar, explored Newfoundland and Labrador, claiming them as part of the Portuguese Empire, in a failed attempt to find the Northwest Passage. After European settlement, colonists first called the island Terra Nova, from “New Land” in Portuguese and Latin. In 1506, King Manuel I of Portugal created taxes for the cod fisheries in Newfoundland waters. João Álvares Fagundes and Pêro de Barcelos established seasonal fishing outposts in Newfoundland and Nova Scotia around 1521, and older Portuguese settlements may have existed. In 1542, Basque mariners came ashore at a natural harbor on the north east coast of the Strait of Belle Isle. They gave this “new land” its Latin name Terranova. A whaling station was set up around the bay, which they called Butus, now named Red Bay after the red terracotta roof tiles they brought with them. A whaling ship, the San Juan, sank there in 1565 and was raised in 1978. Sometime before 1563, Basque fishermen, who had been fishing cod shoals off Newfoundland’s coasts since the beginning of the sixteenth century, founded Plaisance (today Placentia), a seasonal haven which French fishermen later also used. In the Newfoundland will, now in an archive in Spain, of the Basque seaman Domingo de Luca dated 1563 de Luca asks “that my body be buried in this port of Plazençia in the place where those who die here are usually buried.” This will is the oldest known civil document written in Canada. Sir Humphrey Gilbert, under Royal Charter of Queen Elizabeth I of England, landed in St John’s on August 5, 1583, and formally claimed Newfoundland as England’s first overseas colony, thus officially establishing a fore-runner to the much later British Empire. Newfoundland is considered Britain’s oldest colony. At the time of English settlement, the Beothuk inhabited the island. These indigenous people spoke an Amerindian language of the same name. Later immigrants developed a variety of dialects associated with settlement on the island: Newfoundland English and Newfoundland French. In the nineteenth century, it also had a dialect of Irish known as Newfoundland Irish. Scottish Gaelic was spoken on the island during the nineteenth and early twentieth centuries, particularly in the Codroy Valley area, chiefly by settlers from Cape Breton Island, Nova Scotia. The Gaelic names reflected the association with fishing: in Scottish Gaelic, it was called Eilean a’ Trosg, or literally, “Island of the Cod”. Similarly, the Irish Gaelic name Talamh an Éisc means “Land of the Fish”. Though English fishing boats had visited Newfoundland continuously since Cabot’s second voyage in 1498 and seasonal fishing camps had existed for a century prior, the Basque, French, and Portuguese had done likewise. In 1585, however, this changed: Bernard Drake led a devastating raid on the Spanish and Portuguese fisheries from which they never recovered. This provided an opportunity to secure the island and led to the appointment of Proprietary Governors to establish colonial settlements on the island from 1610 to 1728. On July 5, 1610, John Guy set sail from Bristol, England with 39 other colonists. Guy became governor of the first British settlement at Cuper’s Cove. This, and other early attempts at permanent settlement failed to make a profit for the English investors, but some settlers remained, forming the very earliest modern European population on the island. By 1620, the fishermen of England’s West Country dominated the east coast of Newfoundland. French fishermen dominated the island’s south coast and Northern Peninsula. Other settlements included Bristol’s Hope, Renews, New Cambriol, South Falkland and Avalon (which became a province in 1623). The first governor given jurisdiction over all of Newfoundland was Sir David Kirke in 1638. Explorers realized that the waters around Newfoundland had the best fishing in the North Atlantic. By 1620, 300 fishing boats worked the Grand Banks, employing some 10,000 sailors; many continuing to come from the Basque Country, Normandy, or Brittany. They dried and salted cod on the coast and sold it to Spain and Portugal. Heavy investment by Sir George Calvert, 1st Baron Baltimore, in the 1620s in wharves, warehouses, and fishing stations failed to pay off. French raids hurt the business, and the weather was terrible, so he redirected his attention to his other colony in Maryland. After Calvert left, small-scale entrepreneurs such as Sir David Kirke made good use of the facilities. Kirke became the first governor of Newfoundland in 1638. A triangular trade with New England, the West Indies, and Europe gave Newfoundland an important economic role. By the 1670s, there were 1700 permanent residents and another 4500 in the summer months. In 1655, France appointed a governor in Plaisance, the formerly Basque fishing settlement, thus starting a formal French colonization period in Newfoundland as well as a period of periodic war and unrest between England and France in the region. The Mi’kmaq, as allies of the French, were amenable to limited French settlement in their midst and fought alongside them against the English. English attacks on Placentia provoked retaliation by New France explorer Pierre Le Moyne d’Iberville who during King William’s War in the 1690s destroyed nearly every English settlement on the island. The entire population of the English colony was either killed, captured for ransom, or sentenced to expulsion to England, with the exception of those who withstood the attack at Carbonear Island and those in the then remote Bonavista. After France lost political control of the area after the Siege of Port Royal in 1710, the Mí’kmaq engaged in warfare with the British throughout Dummer’s War (1722–1725), King George’s War (1744–1748), Father Le Loutre’s War (1749–1755) and the French and Indian War (1754–1763). The French colonization period lasted until the Treaty of Utrecht of 1713, which ended the War of the Spanish Succession: France ceded to the British its claims to Newfoundland (including its claims to the shores of Hudson Bay) and to the French possessions in Acadia. Afterward, under the supervision of the last French governor, the French population of Plaisance moved to Île Royale (now Cape Breton Island), part of Acadia which remained then under French control. After 1713, with the Treaty of Utrecht, the French ceded control of south and north shores of Newfoundland to the British. French fishermen gained the right to land and cure fish on the “French Shore” on the western coast. They kept only the nearby islands of St. Pierre and Miquelon, located in the fish-rich Grand Banks off the south coast; they gave up their French Shore rights in 1904. In 1783, the British signed the Treaty of Paris with the United States that gave American fishermen similar rights along the coast. These rights were reaffirmed by treaties in 1818, 1854 and 1871 and confirmed by arbitration in 1910. Despite some early settlements by the English, the Crown discouraged permanent, year-round settlement of Newfoundland by migratory fishery workers. During the Seven Years’ War (1756–1763), control of Newfoundland once again became a major source of conflict between Britain, France and Spain who all pressed for a share in the valuable fisheries there. Britain’s victories around the globe led William Pitt to insist that nobody other than Britain should have access to Newfoundland. The Battle of Signal Hill took place in Newfoundland in 1762 when a French force landed and tried to occupy the island, only to be repulsed by the British. From 1763 to 1767 James Cook made a detailed survey of the coasts of Newfoundland and southern Labrador while commander of the HMS Grenville. The following year, 1768, Cook began his first circumnavigation of the world. In 1796, a Franco-Spanish expedition again succeeded in raiding the coasts of Newfoundland and Labrador, destroying many of the settlements. In 1854 the British government established Newfoundland’s responsible government. In 1855, Philip Francis Little, a native of Prince Edward Island, won a parliamentary majority over Hugh Hoyles and the Conservatives. Little formed the first Newfoundland administration (1855-1858). January 1, 1857, saw the issue of the first postage stamps of Newfoundland, portraying a rose, thistle and shamrock. The denominations of these stamps were in pence and they were inscribed ST. JOHN’S NEWFOUNDLAND (Scott #1-9). The designs, engraving of dies and plates, and printing were done by Perkins, Bacon & Co., London. The first stamps were on thick, porous wove paper with mesh and without watermarks. The set consisted of nine imperforate values: 1 penny brown violet, 2 pence scarlet vermilion, 3 pence green, 4 pence scarlet vermilion, 5 pence brown violet, 6 pence scarlet vermilion, 6½ pence scarlet vermilion, 8 pence scarlet vermilion, and 1 shilling scarlet vermilion. Thus, Newfoundland was provided with a more extensive assortment of denominations than any of the other British North American colonies. Further printings from the same plates, but in different colors, were made in 1860 (Scott #11-15) and in 1861-62 (two printings, Scott #15A-23). These were on thinner wove paper without mesh, bearing the papermarker’s watermark, STACEY WISE 1858. This watermark shows occasionally on all the stamps of this issue. The paper, although thinner than that of 1857, varies considerably in thickness, particularly in the 1861 printings. The 1857 consignment included 70,000 one penny stamps; by the end of 1858, only 3,321 had been sold. Naturally, no further supply was ordered in 1860 but the November 1861 printing (Scott #15A) included 10,080 which were never really required, the 1857 stamps being still available after the change to dollar currency. The 1861 printing was in a different color (violet brown), but at least two sheets were in a different color, reddish brown (Scott #16). These are not shown in the Perkins, Bacon & Co. records and were probably the first printed. It has been surmised that the ink was found to be too fluid and was thickened which changed its color. The 1857 issue had 3,000 2 pence stamps that were shipped with the other values in the set but were not put on sale until February 15. By December 31, 1858, only 652 had been sold. Oddly, a further 5,000 were ordered in 1860 (Scott #11, orange). It seems likely that the sale of this stamp increased considerably in 1859, possibly by being used to make up the 6-pence Packet rate to England for letters up to one-half ounce. The 6 pence stamp supplies may have been exhausted early in that year. Each of the two consignments in 1861 had 5,000 of the 2 pence stamps in rose (Scott #17). Sixteen thousand of the 3 pence stamps in green were in the 1857 set, paying the internal letter rate. Some 4,320 were sold in two years. Six thousand were received in 1860 and the July and November 1861 consignments (Scott #11A) had 20,000 and 50,000 respectively. There were remainders of these for many years. The 1857 stamp is rare, especially unused, and the majority of the stamps alleged to be Scott #3 are actually #11A on fairly thick sheets of the watermarked paper. Five thousand scarlet vermilion 4 pence stamps were issued in 1857. This value was used on letters to Nova Scotia and New Brunswick, and to the United States via Halifax. In two years, 3,500 were used and so it was reasonable that another 5,000 were ordered in the orange printing of 1860 (Scott #12); 18,000 rose stamps were printed in July 1861 and 20,000 in November (Scott #18). Of these, 18,141 were still in stock in April 1889. Eleven thousand of the 1857 5 pence value were ordered in the first printing, which was in the same shade as of 1 penny of this set, brown violet. In two years, only 84 were sold! Despite this, 20,000 were ordered in 1860 (Scott #12A, violet brown) and 10,000 in November 1861 (Scott #19, reddish brown and #19a, orange brown). Of these, 17,205 remained in stock in April 1889. Of the 5,000 scarlet vermilion 6 pence stamps released in 1857, 4,403 were sold by the end of 1858. The value must have been exhausted soon afterwards, and its rate must have been paid by multiples of the lower denominations or bisects of the one shilling stamp. Ten thousand orange stamps were printed in 1861 (Scott #13) and 70,000 rose in 1861 (Scott #20). The remainders in 1889 totaled 29,937 and the stamps were available until well into the twentieth century. The 6½ pence denomination was not used much. Two thousand were issued in 1857 and just 325 were sold in two years. It was not reordered in 1860. However, one sheet in orange exists — a trial sheet pulled from the plate before it was realized that the denomination was not included in the order. It is mentioned in Scott as a “souvenir” but no catalogue number is assigned. Fifteen thousand of this value in rose were printed in 1861 (Scott #21). The 8 pence value served no reasonable postal purpose and it is difficult to comprehend why 8,000 were printed in 1857. On cover, it is usually only seen bisected to pay the 4 pence rate (double internal book and magazines per ounce). Only 179 were sold in two years, and the denomination was not reprinted in 1860, but 10,000 were printed in rose in November 1861 (Scott #22). These stamps, however, were not issued before the introduction of the dollar currency and all used copies are philatelic usages from a later period. The one shilling scarlet vermilion printing of 1857 comprised 2,000 stamps, of which 284 were sold by the end of 1858. In 1860, one thousand were printed in orange (Scott #15), the smallest number of any Newfoundland stamp and only twice the number of the famous one penny and 2 pence “Post Office” Mauritius. Two sheets are known on laid paper, one horizontally and one vertically laid. These were probably trial proofs taken after cleaning and preparing the plate and before regular printing commenced. Fifteen thousand of the 1 shilling denomination were printed in rose in 1861 (Scott #23). Formal mail service to and from the Labrador began in 1863 when the Newfoundland let the first mail contract. In 1865, Newfoundland issued its first stamps in dollar currency, including the first pictorials: 2 cent green portraying a codfish (Scott #24), 5 cent brown harp seal (Scott #25), 10 cent black with a portrait of Prince Albert (Scott #27), 12 cent pale red brown Queen Victoria (Scott #28), 13 cent orange fishing ship (Scott #30), and 24 cent blue Queen Victoria on thin transluscent paper (Scott #31). These were simply inscribed NEWFOUNDLAND. The island rejected confederation with Canada in the 1869 general election. Prime Minister of Canada Sir John Thompson came very close to negotiating Newfoundland’s entry into Confederation in 1892. Newfoundland remained a colony until acquiring Dominion status in 1907. A dominion constituted a self-governing state of the British Empire or British Commonwealth and the Dominion of Newfoundland was relatively autonomous from British rule. The European immigrants, mostly English, Scots, Irish and French, built a society in the New World unlike the ones they had left. It was also different from those other immigrants would build on the North American mainland. As a fish-exporting society, Newfoundland was in contact with many ports and societies around the Atlantic rim. Its geographic location and political distinctiveness isolated it from its closest neighbors, Canada and the United States. Internally, most of its population was spread widely around a rugged coastline in small outport settlements. Many were distant from larger centers of population and isolated for long periods by winter ice or bad weather. These conditions had an effect on the cultures of the immigrants. They generated new ways of thinking and acting. Newfoundland and Labrador developed a wide variety of distinctive customs, beliefs, stories, songs and dialects. The First World War had a powerful and lasting effect on the society. From a population of about a quarter of a million, 5,482 men went overseas. Nearly 1,500 were killed and 2,300 wounded. On July 1, 1916, on the first day on the Somme at Beaumont-Hamel, France, 753 men of the 1st Newfoundland Regiment went over the top of a trench. The next morning, only 68 men answered the roll-call. Despite 90 percent casualties, the regiment went on to serve with distinction in several subsequent battles, earning the prefix “Royal”. Newfoundland lost about one-quarter of its young men in the First World War, which had lasting effects on that generation and the next. Even now, when the rest of Canada celebrates the founding of the country on July 1, many Newfoundlanders take part in solemn ceremonies of remembrance. After the war, Newfoundland along with the other dominions sent a separate delegation to the Paris Peace Conference but, unlike the other dominions, Newfoundland neither signed the Treaty of Versailles in her own right nor sought separate membership in the League of Nations. In the 1920s, political scandals wracked the dominion. In 1923, the attorney general arrested Newfoundland’s prime minister Sir Richard Squires on charges of corruption. Despite his release soon after on bail, the British-led Hollis Walker commission reviewed the scandal. Soon after, the Squires government fell. Squires returned to power in 1928 because of the unpopularity of his successors, the pro-business Walter Stanley Monroe and (briefly) Frederick C. Alderdice (Monroe’s cousin), but found himself governing a country suffering from the Great Depression. Since the early 1800s, Newfoundland and Quebec (or Lower Canada) had been in a border dispute over the Labrador region. The Judicial Committee of the Imperial Privy Council resolved this dispute with a ruling on 1 April 1927. Prior to 1867, the Quebec North Shore portion of the “Labrador coast” had shuttled back and forth between the colonies of Lower Canada and Newfoundland. Maps up to 1927 showed the coastal region as part of Newfoundland, with an undefined boundary. The Privy Council ruling established a boundary along the drainage divide separating waters that flowed through the territory to the Labrador coast, although following two straight lines from the Romaine River along the 52nd parallel, then south near 57 degrees west longitude to the Gulf of Saint Lawrence. Modern day Labrador was now considered part of the dominion of Newfoundland. Quebec has long rejected the outcome, and Quebec’s provincially issued maps do not mark the boundary in the same way as boundaries with Ontario and New Brunswick. During the first half of the twentieth century, some of the largest iron ore deposits in the world were discovered in the western part of Labrador and adjacent areas of Quebec. As a small country which relied primarily upon the export of fish, paper, and minerals, Newfoundland was hit very hard by the Great Depression. Economic frustration combined with anger over government corruption led to a general dissatisfaction with democratic government. On April 5, 1932, a crowd of 10,000 people marched on the Colonial Building (seat of the House of Assembly) and forced Prime Minister Squires to flee. Squires lost an election held later in 1932. The next government, led once more by Alderdice, called upon the British government to take direct control until Newfoundland could become self-sustaining. The United Kingdom, concerned over Newfoundland’s likelihood of defaulting on its war-debt payments, established the Newfoundland Royal Commission, headed by a Scottish peer, William Mackenzie, 1st Baron Amulree. Its report, released in 1933, assessed Newfoundland’s political culture as intrinsically corrupt and its economic prospects as bleak, and advocated the abolition of responsible government and its replacement by a Commission of the British Government. Acting on the report’s recommendations, Alderdice’s government voted itself out of existence in December 1933. On February 16, 1934, the Commission of Government took control, ending 79 years of responsible government. Newfoundland remained a dominion in name only. Newfoundland was ruled by a governor who reported to the colonial secretary in London. The Commission consisted of seven persons appointed by the British government. For 15 years no elections took place, and no legislature was convened. The severe worldwide Great Depression persisted until the Second World War broke out in 1939. The Second World War also had a lasting effect on Newfoundland. Given its strategic location in the Battle of the Atlantic, the Allies (especially the United States of America) built many military bases there. Large numbers of unskilled men gained the first paychecks they had seen in years by working on construction and in dockside crews. National income doubled as an economic boom took place in the Avalon Peninsula and to a lesser degree in Gander, Botwood, and Stephenville. In particular, the United States assigned forces to the military bases at Argentia, Gander, Stephenville, Goose Bay and St. John’s. The U.S. became the main supplier, and American money and influence diffused rapidly from the military, naval, and air bases. Prosperity returned to the fishing industry by 1943. Government revenues, aided by inflation and new income, quadrupled, even though Newfoundland had tax rates much lower than those in Canada, Britain, or the United States. To the astonishment of all, Newfoundland started financing loans to London. Wartime prosperity ended the long depression and reopened the question of political status. The American Bases Act became law in Newfoundland on June 11, 1941, with American personnel creating drastic social change on the island. This included significant intermarriage between Newfoundland women and American personnel. A new political party formed in Newfoundland to support closer ties with the U.S., the Economic Union Party. Advocates of union with Canada denounced the Economic Union Party as republican, disloyal and anti-British, no American initiative for union was ever created. Labrador played strategic roles during both World War II and the Cold War. In October 1943, a German U-boat crew installed an automated weather station on the northern tip of Labrador near Cape Chidley, code–named Weather Station Kurt; the installation of the equipment was the only (known) armed, German military operation on the North American mainland during the war. The station broadcast weather observations to the German navy for only a few days, but was not discovered until the 1980s when a historian, working with the Canadian Coast Guard, identified its location and mounted an expedition to recover it. The station is now exhibited in the Canadian War Museum. The Canadian government built a major air force base at Goose Bay, at the head of Lake Melville during the Second World War, a site selected because of its topography, access to the sea, defensible location, and minimal fog. During the Second World War and the Cold War, the base was also home to American, British, and later German, Dutch, and Italian detachments. Today, Serco, the company contracted to operate CFB Goose Bay is one of the largest employer for the community of Happy Valley-Goose Bay. Additionally, both the Royal Canadian Air Force and United States Air Force built and operated a number of radar stations along coastal Labrador as part of the Pinetree Line, Mid-Canada Line and DEW Line systems. Today the remaining stations are automated as part of the North Warning System, however the military settlements during the early part of the Cold War surrounding these stations have largely continued as local Innu and Inuit populations have clustered near their port and airfield facilities. As soon as prosperity returned during the war, agitation began to end the Commission of Government. Newfoundland, with a population of 313,000 (plus 5,200 in Labrador), seemed too small to be independent. In 1945, London announced that a Newfoundland National Convention would be elected to advise on what constitutional choices should be voted on by referendum. Union with the United States was a possibility, but Britain rejected the option and offered instead two options, return to dominion status or continuation of the unpopular Commission. Canada cooperated with Britain to ensure that the option of closer ties with America was not on the referendum. In 1946, an election took place to determine the membership of the Newfoundland National Convention, charged with deciding the future of Newfoundland. The Convention voted to hold a referendum to decide between continuing the Commission of Government or restoring responsible government. The Confederates were led by the charismatic Joseph Smallwood, a former radio broadcaster, who had developed socialist political inclinations while working for a socialist newspaper in New York City. His policies as premier were closer to liberalism than socialism. He moved for the inclusion of a third option — that of confederation with Canada. The Convention defeated his motion, but he did not give up, instead gathering more than 5,000 petition signatures within a fortnight, which he sent to London through the governor. Britain insisted that it would not give Newfoundland any further financial assistance, but added this third option of having Newfoundland join Canada to the ballot. After much debate, the first referendum took place on June 3, 1948, to decide between continuing with the Commission of Government, reverting to dominion status, or joining the Canadian Confederation. Three parties participated in the referendum campaign: Smallwood’s Confederate Association campaigned for the confederation option while in the anti-confederation campaign Peter Cashin’s Responsible Government League and Chesley Crosbie’s Economic Union Party (both of which called for a vote for responsible government) took part. No party advocated petitioning Britain to continue the Commission of Government. The result proved inconclusive, with 44.5 percent supporting the restoration of dominion status, 41.1 percent for confederation with Canada, and 14.3 percent for continuing the Commission of Government. Between the first and second referendums, rumor had it that Catholic bishops were using their religious influence to alter the outcome of the votes. The Orange Order, incensed, called on all its members to vote for confederation, as the Catholics voted for responsible government. The Protestants of Newfoundland outnumbered the Catholics by a ratio of 2:1. Some commentators believe that this sectarian divide influenced the outcome of the second referendum, on July 22, 1948, which asked Newfoundlanders to choose between confederation and dominion status. The populations of Newfoundland and Labrador voted 52.3% to 47.7% in favor of joining Canada as provinces. Opposition was concentrated among residents of the capital St. John’s, and on the Avalon Peninsula. Newfoundland joined Canada in the last hours of March 31, 1949. Its permanent population was only 6,000 at the time. Following confederation, Smallwood led Newfoundland for decades as the elected premier. He was said to have a “cult of personality” among his many supporters. Some residents featured photographs of “Joey” in their living rooms in a place of prominence. Union with Canada has done little to reduce Newfoundlanders’ self-image as a unique group. In 2003, 72% of residents responding identified first as Newfoundlanders, secondarily as Canadians. Separatist sentiment is low, though, less than 12% in the same 2003 study. On April 1, 1949, the day following Newfoundland joining the Confederation, Canada Post Office issued a 4-cent stamp featuring the Matthew, the ship sailed by John Cabot when he discovered Newfoundland in 1497 (Scott #282). This was the first time a FIRST DAY OF ISSUE cancellation was produced by Canada Post Office. The stamp design was based on a model of the Matthew which had been built by Ernest Maunder of St. John’s in 1947 at the request of the Newfoundland Historical Society. Stamp designer Herman Herbert Schwartz used a photograph of Maunder’s model taken on his lawn with “the wind billowing out the sails”. Two years previously, on June 23, 1947, Newfoundland had released its final general issue stamp; four postage due stamps would be the last issued by the dominion in early 1949. Scott #270 also featured the Matthew, this time from the deck, commemorating the 450th anniversary of Cabot’s arrival off Cape Bonavista. The 5-cent rose violet stamp, was engraved and perforated 12½. John Cabot (Giovanni Caboto) was born in Italy, the son of Giulio Caboto and his wife; he had a brother Piero. He is known today as Giovanni Caboto in Italy (as Zuan Chabotto in Venetian), in English as John Cabot, in French as Jean Cabot, and in Spanish as Juan Caboto. The non-Italian forms are derived from how his name was recorded in related fifteenth-century documents. In Venice he signed his names as “Zuan Chabotto“, “Zuan” being a form of “John” typical to Venice. He continued to use this form in England, at least among Italians. He was referred to by his Italian banker in London as ‘Giovanni Chabbote‘, in the only known contemporary document to use this version of his first name. Gaeta (in the Kingdom of Naples, present-day Province of Latina) and Castiglione Chiavarese (in the Republic of Genoa) have both been proposed as birthplaces. The main evidence for Gaeta are records of a Caboto family residing there until the mid-fifteenth century, but ceasing to be traceable after 1443. Pedro de Ayala, the Spanish envoy and Cabot’s contemporary in London, described him in a letter to the Spanish Crown in 1498 as “another Genoese like Columbus”. John Cabot’s son, Sebastian, said his father originally came from Genoa. In 1476, Cabot was made a citizen of the Republic of Venice, which required a minimum of fifteen years’ residency in the city; thus he must have lived in Venice since at least 1461. Cabot may have been born slightly earlier than 1450, which is the approximate date most commonly given for his birth. In 1471, he was accepted into the religious confraternity of Saint John the Evangelist. Since this was one of the city’s prestigious confraternities, his acceptance suggests that he was already a respected member of the community. Following his gaining full Venetian citizenship in 1476, Caboto would have been eligible to engage in maritime trade, including the trade to the eastern Mediterranean that was the source of much of Venice’s wealth. He presumably entered this trade shortly thereafter. A 1483 document refers to his selling a slave in Crete whom he had acquired while in the territories of the Sultan of Egypt, which then comprised most of what is now Israel, Syria and Lebanon. This is not sufficient to prove Cabot’s later assertion that he had visited Mecca, which he said in 1497 to the Milanese ambassador in London. In this Mediterranean trade, he may have acquired better knowledge of the origins of the oriental (West Asian) merchandise he would have been dealing in (such as spices and silks) than most Europeans at that time. “Zuan Cabotto” (i.e. John Cabot) is mentioned in a variety of Venetian records of the 1480s. These indicate that by 1484 he was married to Mattea and already had at least two sons. Cabot’s sons are Ludovico, Sebastian, and Sancto. The Venetian sources contain references to Cabot’s being involved in house building in the city. He may have relied on this experience when seeking work later in Spain as a civil engineer. Cabot appears to have got into financial trouble in the late 1480s and left Venice as an insolvent debtor by November 5, 1488. He moved to Valencia, Spain, where his creditors attempted to have him arrested by sending a lettera di raccomandazione a giustizia (“a letter of recommendation to justice”) to the authorities. While in Valencia, “John Cabot Montecalunya” (as he is referred to in local documents) proposed plans for improvements to the harbor. These proposals were rejected, however. Early in 1494, he moved on to Seville, where he proposed, was contracted to build and, for five months, worked on the construction of a stone bridge over the Guadalquivir river. This project was abandoned following a decision of the City Council on December 24, 1494. After this, Cabot appears to have sought support in Seville and Lisbon for an Atlantic expedition, before moving to London to seek funding and political support. He likely reached England in mid-1495. Like other Italian explorers, including Christopher Columbus, Cabot led an expedition on commission to another European nation, in his case, England. Historians had thought that, on arrival in England, Cabot went to Bristol, a major maritime center, to seek financial backers. This was the only English city to have had a prior history of undertaking exploratory expeditions into the Atlantic. Cabot’s royal patent (issued by the Crown in 1496) stated that all expeditions should be undertaken from Bristol, so his primary financial supporters likely were based in that city. In any case, it also stipulated that the commerce resulting from any discoveries must be conducted with England alone. In the late twentieth century, British historian Alwyn Ruddock claimed to have found documentation that Cabot went first to London, where he received some financial backing from its Italian community. She suggested one patron was Father Giovanni Antonio de Carbonariis, an Augustinian friar who was also the deputy to Adriano Castellesi, the papal tax collector. Dr. Ruddock suggested that Carbonariis accompanied Cabot’s 1498 expedition. She also suggested that the friar, on good terms with the King, introduced the explorer to King Henry VII. Beyond this, Ruddock claimed that Cabot received a loan from an Italian banking house in London. As Ruddock ordered the destruction of all her research notes on her death in 2005, scholars have had to duplicate her research and rediscover documents. The Cabot Project was formed at the University of Bristol in 2009 to research Cabot and the Bristol expeditions. Dr Francesco Guidi Bruscoli (University of Florence) found some of Ruddock’s documentation, confirming that Cabot received money in March 1496 from the Bardi family banking firm of Florence. The bankers located in London provided fifty nobles (£16 13s. 4d.) to support Cabot’s expedition to “go and find the new land”. This payment from the Florentine merchants would have represented a substantial contribution, although it was not enough to completely finance the expedition. On March 5, 1496, King Henry VII gave Cabot and his three sons letters patent with the following charge for exploration: “…free authority, faculty and power to sail to all parts, regions and coasts of the eastern, western and northern sea, under our banners, flags and ensigns, with five ships or vessels of whatsoever burden and quality they may be, and with so many and with such mariners and men as they may wish to take with them in the said ships, at their own proper costs and charges, to find, discover and investigate whatsoever islands, countries, regions or provinces of heathens and infidels, in whatsoever part of the world placed, which before this time were unknown to all Christians.“ Since Cabot received his royal patent in March 1496, it is believed he made his first expedition from Bristol that summer. A winter 1497-98 letter from John Day (a Bristol merchant) to an addressee believed to be Christopher Columbus refers briefly to it, but writes mostly about the second, 1497 voyage. He notes, “Since your Lordship wants information relating to the first voyage, here is what happened: he went with one ship, his crew confused him, he was short of supplies and ran into bad weather, and he decided to turn back.” Information about the second expedition, made in 1497, is mainly derived from four short letters and the following full entry for 1496/7 in the 1565 Chronicles of Bristol: “This year, on St. John the Baptist’s Day [June 24, 1497], the land of America was found by the Merchants of Bristow in a shippe of Bristowe, called the Mathew; the which said the ship departed from the port of Bristowe, the second day of May, and came home again the 6th of August next following.“ The “John Day letter” provides considerable information about this second voyage. It was written during the winter of 1497-1498 by Bristol merchant John Day (alias Hugh Say of London) to a man who is likely Christopher Columbus. Day is believed to have been familiar with the key figures of the expedition and thus able to report on it. If the lands Cabot had discovered lay west of the meridian laid down in the Treaty of Tordesillas, or if he intended to sail further west, Columbus would likely have believed that these voyages challenged his monopoly rights for westward exploration. In addition to these letters, Dr Alwyn Ruddock claimed to have found another, written on August 10, 1497, by the London-based bankers of Fr. Giovanni Antonio de Carbonariis. This letter has yet to be found. From various written comments made by Ruddock, the letter did not appear to contain a detailed account of the voyage. Ruddock said the letter contained “new evidence supporting the claim that seamen of Bristol had already discovered land across the ocean before John Cabot’s arrival in England.” She contended that Bristol seamen had reached North America two decades before Cabot’s expedition. The known sources do not concur on all aspects of the events, and none can be assumed to be entirely reliable. The crew was said to have included an unnamed Burgundian (modern- day Netherlands) and a Genoese barber, who presumably accompanied the expedition as the ship’s surgeon. It is likely that two ranking Bristol merchants were part of the expedition. One was probably William Weston, who had not been identified as part of Cabot’s expedition before the find of a new document in the late twentieth century. His participation was confirmed by a document found in the early twenty-first century noting his reward from the King in January 1498 after the ship returned. More importantly, in 2009 historian Evan Jones confirmed that Weston had undertaken an independent voyage to the New Found Land in 1499, probably under Cabot’s patent, as the first Englishman to lead an expedition to North America. Lack of clear documentation has also been a problem in studying the history of Cabot’s ship, the Matthew. Even its name has been questioned, with some authors suggesting that it was actually named Mattea after Cabot’s wife. Until the 1950s, all that was known about its size is that it was a small ship carrying about 18 men, but the discovery of the “John Day letter” saying that “in his voyage he had only one ship of fifty ‘toneles’ and twenty men and food for seven or eight months” provided more certainty about its size. The ship is described on the Heritage Newfoundland & Labrador website as a navicula, “meaning a relatively small vessel, of 50 toneles — able to carry 50 tons of wine or other cargo. It was decked, with a high sterncastle and three masts. The two forward masts carried square mainsails to propel the vessel forward. The rear mast was rigged with a lateen sail running in the same direction as the keel, which helped the vessel sail into the wind.” The age of the ship is also uncertain. The name Matthew does not appear in the 1492-1493 customs accounts, so it was either fairly new or an older ship renamed or a foreign ship. It has been suggested that it probably was an ordinary Bristol merchant ship hired for the occasion. The name Matthew appears in documents in 1503-1504 and 1510-1511 but in a 1513 survey there is reference to a ‘new Matthew‘ and references to this ship afterward leave out the ‘new’ suggesting that Cabot’s Matthew no longer existed. Cabot departed either May 2 or 20, 1497, and sailed to Dursey Head (latitude 51°36N), Ireland, from where he sailed due west across the Atlantic, expecting to reach Asia, making landfall somewhere on the coast of North America on June 24, 1497. The exact location of the landfall has long been disputed, with different communities vying for the honor. Historians have proposed Cape Bonavista and St. John’s in Newfoundland; Cape Breton Island (Nova Scotia); as well as Labrador and Maine in the United States as possibilities. Since the discovery of the “John Day letter” in the 1950s, it seems most likely that the initial landfall was either on Newfoundland or Cape Breton Island. This is because Day’s letter implies that the coastline explored in 1497 lay between the latitudes of the Bordeaux River in France and Dursey Head in southern Ireland. The initial landfall seems to have taken place close to the southern latitude, with the expedition returning home after reaching the northern one. For the 500th-anniversary celebrations, the governments of Canada and the United Kingdom designated Cape Bonavista in Newfoundland as the “official” landing place. Here in 1997, Queen Elizabeth II, along with members of the Italian and Canadian governments, greeted the replica Matthew of Bristol, following its celebratory crossing of the Atlantic. Cabot’s expedition is believed to be the first by Europeans to mainland North America since the Vikings five hundred years before. Cabot is reported to have landed only once during the expedition and did not advance “beyond the shooting distance of a crossbow”. Pasqualigo and Day both state that the expedition made no contact with any native people; crew found the remains of a fire, a human trail, nets and a wooden tool. The crew appeared to have remained on land just long enough to take on fresh water; they also raised the Venetian and Papal banners, claiming the land for the King of England and recognizing the religious authority of the Roman Catholic Church. After this landing, Cabot spent some weeks “discovering the coast,” with most “discovered after turning back.” Cabot probably departed on July 20. On the homeward voyage, his sailors incorrectly thought they were going too far north, so Cabot sailed a more southerly course, reaching Brittany instead of England. On August 6, he arrived back in Bristol. On return to Bristol, Cabot rode to London to report to the King. On August 10, 1497, he was given a reward of £10 — equivalent to about two years’ pay for an ordinary laborer or craftsman. The explorer was feted; Soncino wrote on August 23 that Cabot “is called the Great Admiral and vast honour is paid to him and he goes dressed in silk, and these English run after him like mad”. Such adulation was short-lived, for over the next few months the King’s attention was occupied by the Second Cornish Uprising of 1497, led by Perkin Warbeck. Once Henry’s throne was secure, he gave more thought to Cabot. On September 26, just a few days after the collapse of the revolt, the King made an award of £2 to Cabot. In December 1497, the explorer was awarded a pension of £20 per year. On February 3, 1498 he was given new letters patent covering the voyage and to help him prepare a new expedition. The Great Chronicle of London (1189–1512) reports that Cabot departed with a fleet of five ships from Bristol at the beginning of May 1498, one of which had been prepared by the King. Some of the ships were said to be carrying merchandise, including cloth, caps, lace points and other “trifles”. This suggests that Cabot intended to engage in trade on this expedition. The Spanish envoy in London reported in July that one of the ships had been caught in a storm and been forced to land in Ireland, but that Cabot and the other four ships had continued on. For centuries no other records were found (or at least published) that relate to this expedition; it was long believed that Cabot and his fleet were lost at sea. But at least one of the men scheduled to accompany the expedition, Lancelot Thirkill of London, is recorded as living in London in 1501. The historian Alwyn Ruddock worked on Cabot and his era for 35 years. She suggested that Cabot and his expedition successfully returned to England in the spring of 1500. She claimed their return followed an epic two-year exploration of the east coast of North America, south into the Chesapeake Bay area and perhaps as far as the Spanish territories in the Caribbean. Her evidence included the well-known world map of the Spanish cartographer Juan de la Cosa. His chart included the North American coast and seas ‘discovered by the English’ between 1497 and 1500. Dr. Ruddock suggested Fr. Giovanni Antonio de Carbonariis and the other friars who accompanied the 1498 expedition had stayed in Newfoundland and founded a mission. If Carbonariis founded a settlement in North America, it would have been the first Christian settlement on the continent, and may have included a church, the only medieval church to have been built there. Ruddock also claimed that William Weston of Bristol, a supporter of Cabot, undertook an independent expedition to North America in 1499, sailing north from Newfoundland up to the Hudson Strait. If correct, this was probably the first Northwest Passage expedition. In 2009, Evan Jones confirmed that William Weston (who was not previously known to have been involved) led an expedition from Bristol with royal support to the “new found land” in 1499 or 1500, making him the first Englishman to lead exploration of North America. This find has changed the understanding of English roles in exploration of that continent. King Henry VII continued to support exploration from Bristol. The king granted Hugh Eliot, Robert Thorne and his son a bounty of ₤20 in January 1502 for purchasing the Gabriel, a ship for an expedition voyage that summer. Later in 1502 or early 1503, he paid Eliot a reward of ₤100 for a voyage, or voyages, in “2 ships to the Isle of new finding,” as Newfoundland was called. This amount was larger than any previously accounted for in royal support of the explorations. The circumstances of John Cabot’s death appear obscure and contradictory. He was last mentioned as a member of an expedition led by his son Sebastian in 1508-1509. Nothing is known about Cabot after that; perhaps he died during the journey, or more likely shortly after returning. The Cabot Project at the University of Bristol was organized in 2009 to search for the evidence on which Ruddock’s claims rest, as well as to undertake related studies of Cabot and his expeditions. The lead researchers on the project, Evan Jones and Margaret Condon, claim to have found further evidence to support aspects of Ruddock’s case, including some of the information she intended to use to argue for a successful return of the 1498 expedition to Bristol. These appear to place John Cabot in London by May 1500, albeit Jones and Condon have yet to publish their documentation. The Project is collaborating on an archaeological excavation at the community of Carbonear, Newfoundland, located at Conception Bay and believed the likely location for Carbonariis’ mission settlement. The Archaeology of Historic Carbonear Project, carried out by Memorial University of Newfoundland, has conducted summer fieldwork each season since 2011. So far, it has found evidence of planter habitation since the late seventeenth century and of trade with Spain through Bilbao, including a Spanish coin minted in Peru. To celebrate the 500th anniversary of Cabot’s voyage, a replica of Matthew was built in Bristol by Storms’l Services, a precursor of the Bristol Classic Boat Company. The design was by naval architect Colin Mudie. She was dedicated in a ceremony during the first International Festival of the Sea, held in Bristol’s Floating Harbour in 1996. The next year, she reconstructed Cabot’s original journey on the 500th anniversary of the landmark voyage. On June 24, 1997, the replica of Matthew was welcomed into port at Bonavista by Queen Elizabeth II. The replica is 78 feet (24 meters) in length overall with a beam of 20 feet, 6 inches (6.25 meters) with a draft of 7 feet (2.1 meters) and 2,360 square feet (219 square meters) of sail. On February 29, 2012, Matthew‘s ownership was transferred to The Matthew of Bristol Trust, and she was relocated to her new home outside Bristol’s M Shed museum. In June 2012, she took part in the Queen’s Diamond Jubilee pageant on the River Thames.
9201
dbpedia
1
5
https://www.wikidata.org/wiki/Q2411666
en
Newfoundland dollar
https://upload.wikimedia…_dollar_bill.jpg
https://upload.wikimedia…_dollar_bill.jpg
[ "https://upload.wikimedia.org/wikipedia/commons/thumb/5/53/NFLD_dollar_bill.jpg/220px-NFLD_dollar_bill.jpg", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://www.wikidata.org/static/images/footer/wikimedia-button.svg", "https://www.wikidata.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[]
null
currency of the Dominion of Newfoundland from 1865 to 1949
en
/static/apple-touch/wikidata.png
https://www.wikidata.org/wiki/Q2411666
currency of the Dominion of Newfoundland from 1865 to 1949
9201
dbpedia
1
10
https://canadacurrency.com/canadian-banknotes/government-of-newfoundland-1920-banknotes/value-of-january-2nd-1920-government-of-newfoundland-1-bill/
en
Value of January 2nd 1920 Government of Newfoundland Value of January 2nd 1920 Government of Newfoundland $1 Bill Bill
https://canadacurrency.c…2018/06/CA82.jpg
[ "https://canadacurrency.com/wp-content/uploads/2022/02/CanadaCurrency_Header.jpg", "https://canadacurrency.com/wp-content/uploads/2016/06/Canada-Auction-Stacks-Banner.jpg", "https://canadacurrency.com/wp-content/uploads/2016/06/Canadian-Coin-Auctions-Stacks.jpg", "https://canadacurrency.com/wp-content/themes/saico-v1.0.3/images/cta-image.jpg", "https://canadacurrency.com/wp-content/uploads/2018/06/CA82.jpg", "http://canadacurrency.com/wp-content/uploads/2013/11/canada-logo4.png", "https://canadacurrency.com/wp-content/uploads/2013/11/canada-banner-bottom2.jpg", "https://canadacurrency.com/wp-content/uploads/2016/06/Sell-Canadian-Currency-NYC-banner.jpg", "https://canadacurrency.com/wp-content/uploads/2013/11/currency_ca_slide2.gif" ]
[]
[]
[ "" ]
null
[]
2013-11-22T19:10:41+00:00
Our guide has pictures and prices for all Newfoundland January 2nd 1920 one dollar bank notes. We provide free appraisals and we are also buyers. Please contact us if you want to sell your Canadaian bank note.
en
http://canadacurrency.com/wp-content/uploads/2013/10/canada-flag-Copy.png
Canadian Currency |
https://canadacurrency.com/canadian-banknotes/government-of-newfoundland-1920-banknotes/value-of-january-2nd-1920-government-of-newfoundland-1-bill/
January 2nd 1920 Government of Newfoundland $1 Bill Description: These are very popular bank notes. Each note has a portrait of King George V. The right hand side of the note shows a blue vignette of a caribou. Prices for circulated notes usually range from $100 to $500. High grade notes can be worth significantly more money. Varieties: These can be signed by Bursell and Brownrigg, Hickey and Brownrigg, Keating and Brownrigg, or Renouf and Brownrigg. The Bursell signature commands a small premium over the other notes. Otherwise there are no design or layout differences. Quantity Issued: 600,000 Text: The Government of Newfoundland – Will Pay To Bearer On Demand – St. John’s NFLD. – Jany 2nd 1920 – One Dollar – Countersigned – Minister of Finance and Customers – American Bank Note Co. Ottawa BANK NOTE FRONT: NEED AN APPRAISAL OR WANT TO SELL? We buy all of these 1920 one dollar bank notes from Newfoundland. Values are based purely on condition and occasionally the signature combination. If you would like our offer, then please send us pictures of your bank note. We will grade the paper money and respond back quickly with our buy and sell price. You might be surprised at how much money some high grade Newfoundland bank notes can be worth.
9201
dbpedia
0
70
https://blog.colonialacres.com/history-of-the-two-dollar-canadian-bill/
en
The History Of The Two
https://blog.colonialacr…anadian-bill.png
https://blog.colonialacr…anadian-bill.png
[ "https://blog.colonialacres.com/wp-content/uploads/2022/02/footer-logo-300x269.png", "https://blog.colonialacres.com/wp-content/uploads/2022/02/footer-logo-300x269.png", "https://blog.colonialacres.com/wp-content/uploads/2021/08/The-history-of-the-two-dollar-Canadian-bill-730x228.png", "https://blog.colonialacres.com/wp-content/uploads/2021/08/The-history-of-the-two-dollar-Canadian-bill-500x156.png", "https://blog.colonialacres.com/wp-content/uploads/2021/08/The-history-of-the-two-dollar-Canadian-bill-350x109.png", "https://www.colonialacres.com/cdn/shop/files/logo_42f7cc78-3cd4-4713-b463-96e789dbe6b3.png?v=1716747236", "https://blog.colonialacres.com/wp-content/uploads/2022/02/footer-logo.png", "https://www.colonialacres.com/v/vspfiles/img/fb.png", "https://blog.colonialacres.com/wp-content/uploads/2022/02/BBB-Logo.png" ]
[]
[]
[ "" ]
null
[ "Colonial Acres Coins" ]
2021-08-17T12:25:04-04:00
The two-dollar Canadian bill was discontinued 25 years ago, but getting your hands on one now could be worth a lot! Find out where to find them and more here.
https://blog.colonialacr…2024/07/logo.png
Buy & Sell Royal Canadian Mint Coins - Colonial Acres Coins
https://blog.colonialacres.com/history-of-the-two-dollar-canadian-bill/
Last Updated on May 2, 2024 Posted by Colonial Acres Coins Canada discontinued its two-dollar bill 25 years ago and replaced it with the toonie coin. The government then pulled tender status from this and several other banknotes in 2021. Now, this piece of Canadian paper money can be worth up to tens of thousands of dollars for a rare and perfect note. Two-Dollar Creation The two-dollar bill came into circulation in the 1800s, before the Confederation of Canada. In 1886, the Province of Canada began printing its own Canadian paper money, which included the two-dollar denomination. Starting in 1901, the Dominion of Newfoundland also printed notes that included a two-dollar denomination. It switched currencies when it joined Confederation in 1949. Over the years, the two-dollar bill took on various designs to mark different phases in history. For example, the 1954 version issued by the Bank of Canada had a reddish hue and featured Queen Elizabeth II in her youth. The final version of the note, which was last created in 1986, also included a portrait of Queen Elizabeth II. Like its predecessor, it is reddish in colour and features a picture of the Queen in her older years. Some older versions of the two-dollar bill are green. For example, one dating from 1887 included portraits of the Marquis and Marchioness of Lansdowne, the Governor General and his wife. This note was in circulation shortly after the Canadian West opened up to settlers, following the completion of the Canadian Pacific Railroad. Two-Dollar Stigma The two-dollar bill developed quite a reputation for itself in some parts of Canada. It was considered a key currency in the red-light district in Winnipeg. Consequently, many people outside of the area shunned the two-dollar bill and preferred not to use or own it. In some circles, it was also considered insulting to give someone a two-dollar bill, even if it was the logical change to be returned from a larger bill. For these and other reasons, the two-dollar bill also developed a reputation in the West, where it was noticeably less common. In fact, outside of its association with the red-light district, Western Canadians disliked the bill because it was often considered bad luck. Sometimes, even bankers wanted nothing to do with it. Two-Dollar Replacement Bills of smaller denominations tend to attract more wear and tear than larger bills, such as the $100. Consequently, the Canadian government decided it was time to do away with the smaller denominations, including the two-dollar bill. So, in 1996, the toonie entered circulation as the far more economical choice. While minting a coin costs far more than printing a dollar bill, the cost savings come from the fact that not even polymer notes can match the decades-long life expectancy for coins. Despite its replacement 25 years ago, the recent discontinuation of legal tender status implies that there might be more $2 bills entering the market for collecting. Some people find these bills with the belongings of older relatives. Every so often, a two-dollar bill also surfaces as regular change during cash transactions.
9201
dbpedia
2
69
https://www.facebook.com/Beavercrafts/posts/newfoundland-coins-and-stamps-are-wonderful-keepsakes-of-our-pre-confederation-h/2989214814539454/
en
Facebook
[]
[]
[]
[ "" ]
null
[]
null
de
https://static.xx.fbcdn.net/rsrc.php/yT/r/aGT3gskzWBf.ico
null
9201
dbpedia
3
7
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
en
Dominion of Newfoundland
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
[ "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/30?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/30?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/30?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/125?cb=20110304131402", "https://static.wikia.nocookie.net/formercountries/images/f/f5/Coat_of_Arms_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/105?cb=20110304131409", "https://static.wikia.nocookie.net/formercountries/images/f/fc/Map_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/250?cb=20110304131419", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/22?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/1/14/Red_Ensign_of_Great_Britain.svg/revision/latest/scale-to-width-down/22?cb=20110304134032", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/a/a4/Flag_of_the_United_States.svg/revision/latest/scale-to-width-down/22?cb=20110228004306", "https://static.wikia.nocookie.net/6a181c72-e8bf-419b-b4db-18fd56a0eb60", "https://static.wikia.nocookie.net/6c42ce6a-b205-41f5-82c6-5011721932e7", "https://static.wikia.nocookie.net/464fc70a-5090-490b-b47e-0759e89c263f", "https://static.wikia.nocookie.net/f7bb9d33-4f9a-4faa-88fe-2a0bd8138668" ]
[]
[]
[ "" ]
null
[ "Contributors to The Countries Wiki" ]
null
The Dominion of Newfoundland was a dominion of the United Kingdom in North America.  Canada (Commonwealth realm)  British America (1607-1783)  United Kingdom: British North America (1783-1907)  Canada (From 1867)  United States World Statesmen.org Wikisource 1911 encyclopedia project Wikipedia
en
/skins-ucp/mw139/common/favicon.ico
The Countries Wiki
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
Dominion of the ‌United Kingdom ← 1907–1949 → → Motto Quaerite Prime Regnum Dei Seek ye first the kingdom of God Anthem Ode to Newfoundland Capital St. John's Status Dominion Legislature House of Assembly History - Dominion - Newfoundland Act Currency Newfoundland dollar British North America Canada Newfoundland v The Dominion of Newfoundland was a dominion of the United Kingdom in North America. Nation Canada (Commonwealth realm) Canadian Polities British America (1607-1783) United Kingdom: British North America (1783-1907) Canada (From 1867) Neighbouring Nations United States References
9201
dbpedia
2
74
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
en
Dominion of Newfoundland
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest?cb=20110304131402
[ "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/30?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/30?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/30?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/b/bc/Flag_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/125?cb=20110304131402", "https://static.wikia.nocookie.net/formercountries/images/f/f5/Coat_of_Arms_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/105?cb=20110304131409", "https://static.wikia.nocookie.net/formercountries/images/f/fc/Map_of_the_Dominion_of_Newfoundland.png/revision/latest/scale-to-width-down/250?cb=20110304131419", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/22?cb=20120826215302", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/1/14/Red_Ensign_of_Great_Britain.svg/revision/latest/scale-to-width-down/22?cb=20110304134032", "https://static.wikia.nocookie.net/formercountries/images/f/f9/Red_Ensign.svg/revision/latest/scale-to-width-down/22?cb=20110304133032", "https://static.wikia.nocookie.net/formercountries/images/c/cf/Flag_of_Canada.svg/revision/latest/scale-to-width-down/22?cb=20110304125255", "https://static.wikia.nocookie.net/formercountries/images/a/a4/Flag_of_the_United_States.svg/revision/latest/scale-to-width-down/22?cb=20110228004306", "https://static.wikia.nocookie.net/6a181c72-e8bf-419b-b4db-18fd56a0eb60", "https://static.wikia.nocookie.net/6c42ce6a-b205-41f5-82c6-5011721932e7", "https://static.wikia.nocookie.net/464fc70a-5090-490b-b47e-0759e89c263f", "https://static.wikia.nocookie.net/f7bb9d33-4f9a-4faa-88fe-2a0bd8138668" ]
[]
[]
[ "" ]
null
[ "Contributors to The Countries Wiki" ]
null
The Dominion of Newfoundland was a dominion of the United Kingdom in North America.  Canada (Commonwealth realm)  British America (1607-1783)  United Kingdom: British North America (1783-1907)  Canada (From 1867)  United States World Statesmen.org Wikisource 1911 encyclopedia project Wikipedia
en
/skins-ucp/mw139/common/favicon.ico
The Countries Wiki
https://countries.fandom.com/wiki/Dominion_of_Newfoundland
Dominion of the ‌United Kingdom ← 1907–1949 → → Motto Quaerite Prime Regnum Dei Seek ye first the kingdom of God Anthem Ode to Newfoundland Capital St. John's Status Dominion Legislature House of Assembly History - Dominion - Newfoundland Act Currency Newfoundland dollar British North America Canada Newfoundland v The Dominion of Newfoundland was a dominion of the United Kingdom in North America. Nation Canada (Commonwealth realm) Canadian Polities British America (1607-1783) United Kingdom: British North America (1783-1907) Canada (From 1867) Neighbouring Nations United States References
9201
dbpedia
3
96
http://kpolsson.com/coinhist/canada/
en
Chronology of Canadian Coins
[]
[]
[]
[ "Canada", "Canadian coins", "coins", "numismatic", "history", "Royal Mint", "Royal Canadian Mint", "RCM", "dollar", "quarter", "dime", "nickel", "cent", "gold", "silver", "Maple Leaf", "bullion", "Looney", "Tooney" ]
null
[ "Ken Polsson" ]
null
Timeline of events tracing the history of Canada's decimal coinage, both circulating and collector coins.
null
1842 April 27 The Currency Act of 1841 comes into effect, making legal tender the British sovereign, and the American eagle ($10), dollar, and half-dollar coins. French crowns and half-crowns are no longer legal tender. [169.230] [1003.36] 1850 Inspector-General for the Province of Canada, Francis Hincks, introduces a bill in Parliament, to amend the Currency Act of 1841, giving the Governor General the power to have coins struck for circulation in Canada. [306.133] [571.26] The parliament of the Province of Canada passes acts 13 and 14 to amend the Currency Act, allowing authorized banks to produce coins. [16.19] [276.187] August 10 An Act to amend the 1841 Currency Act receives royal assent, with the signature of Lord Elgin, Governor General of Canada. The Act sets the value of the American dollar in Canada at 5 shillings. The Act also gives Canada's Governor General the power to have silver coins struck for circulation in Canada, in denominations of 5 shillings, 2 shillings 6 pence, 2 shillings, 1 shilling 3 pence, 1 shilling, 6 pence, and 3 pence. These values correspond directly to American currency values of $1, 50c, 40c, 25c, 20c, 10c, and 5c. Gold coins are also provided for, in values of 10 shillings, 12 shillings 6 pence, 1 pound, and 1 pound 5 shillings. The Act is set to become law on January 1, 1851. [176.90] [306.133] [378.182] [571.26] October 24 The British Treasury sends a memorandum to the Colonial Office severely criticizing Canadian Inspector-General Francis Hincks' proposed Currency Act of 1850, and demanding its disallowance. [306.134] October 25 Colonial Secretary Earl Grey informs Lord Elgin that the Currency Act of 1850 should be disallowed, as it was not contingent on the acceptability of the British Government. [306.134] November Francis Hincks replies to the British Treasury stating reasons for Canada to issue its own coinage, and that the Currency Act of 1850 should be allowed to stand, and let the legislature repeal certain sections if they are deemed inappropriate. [306.134] December 5 Earl Grey writes to Lord Elgin, agreeing with Francis Hincks that the Canadian Legislature should have an opportunity to amend the Currency Act of 1850. [306.135] 1851 February 20 The British Treasury replies to Francis Hincks' memorandum of November 1850, refusing to budge on the subject of Canadian currency. [306.135] April 14 An Order-in-Council in England disallows the Canadian Currency Act of 1850. [176.90] [306.135] [571.26] (month unknown) The government of the Province of Canada makes a proposal to the Government in England for a "Canadian pound" in gold, plus decimal coins in silver. The request is denied. [16.19] [276.187] May 14 Francis Hincks writes again to the British Treasury, again stating reasons why Canada should issue its own decimal currency. [306.136] June Representatives of the provinces of Canada, Nova Scotia, and New Brunswick meet in Toronto and agree to work towards a common currency based on the decimal system. [277.108] [662.50] July 4 The British Treasury replies to Francis Hincks' May 14 letter, again stating that regulation of currency is the responsibility of the Crown. [306.137] August 30 The Canadian Currency Act passes in Canadian parliament, specifying a conversion to decimal currency as soon as is convenient, and making the dollar legal tender, up to $10 per transaction. The wording of the Act specifies that any new coins struck for Canada would be done so under the approval of the British Government. (The British government delays giving the Act royal assent.) [176.91] [306.139] [571.26] [1173.44] 1852 June 29 The British Treasury proposes that a distinctive Canadian coin, the pound currency, and called a "Royal", should be issued. The Royal would be equivalent to four US gold dollars. Silver coins of denominations 1/2 crown, 1 shilling, 1/2 shilling, and 1/4 shilling would also be produced. [306.139] [1028.58] vvv advertisement vvv ^^^ advertisement ^^^ November Francis Hincks introduces a new currency Act into the Canadian legislature. The Act specifies that a dollar currency and a pound currency would both be valid. [306.140] 1853 June 14 The Currency Act, 1853, receives royal assent, allowing coins in denominations of dollars and cents to be struck for Canada, as well as shillings and pence. [16.19] [39.1] [176.92] [276.187] [277.109] [306.140] [1023.38] 1854 August 1 The Currency Act of 1853 is proclaimed in England, allowing pounds and dollars to be used for provincial accounts, and providing legal authority for further changes to Canada's monetary system. [277.110] [662.50] [888.46] 1855 The chairman of the Standing Committee on Public Accounts, William Lyon Mackenzie, recommends to parliament that public accounts be kept in a decimal currency based on the U.S. dollar rather than on the British sovereign. No action is taken at the time. [306.142] [571.26] 1856 March 26 William Lyon Mackenzie again introduces a resolution in the House of Commons that Canada's currency should become a decimal system, equal to currency of the US. The resolution is defeated by a vote of 58 to 27. [306.142] [571.26] 1857 March 6 Canadian Inspector-General (Finance Minister) Cayley introduces a bill requiring the Provincial Government of Canada keep accounts in dollars and cents. [176.93] June 10 An act receives royal assent to put the Province of Canada on the decimal (dollar) system of currency, requiring all accounts be kept in dollars and cents. It is to come into effect January 1, 1858. [1] [35.8] [85] [171.95] [176.93] [276.188] [277.110] [306.143] [571.26] [1015.80] (June 19 [397.15]) August 18 Thomas Graham, Master of the Royal Mint announces a forthcoming issue of 15,000 pounds sterling worth each of 5c and 10c pieces, and 2,000 pounds sterling of 20c pieces. [176.93] [306.143] [571.26] October 14 The British Treasury reports that designs for Canada's coins prepared by Leonard Charles Wyon had received approval of Canada's Governor General. [306.143] October 16 The British Treasury approves the Master of the Mint's proposal for determining the weight of the new 20c piece for Canada. The coin will be 71.73 grains of 0.925 fine silver, equal to 5.066 grains of British standard gold. [294.117] [361.285] [662.50] 1858 January 1 By an Act passed in England, the Province of Canada is put on the decimal system of currency. [35.8] [85] [240.419] [286.250] [378.183] [380.191] [1015.80] [1144.441] July 1 The first coins for the Province of Canada are minted in England, in denominations of 1c, 5c, 10c, and 20c. The obverse design of the 1 cent piece was originally intended for use on English coinage, but was rejected, due to its similarity to the bronze coinage of Emperor Napoleon III of France. [1] [662.50] [887.10] (July 2 [1014.56]) July 17 Designs of Leonard Charles Wyon are approved by Queen Victoria, for coins of the Province of Canada: 1c, 5c, 10c, and 20c pieces. [35.8] [294.117] [361.285] [380.191] [1015.80] (month unknown) Inspector-General A.T. Galt requests of the British Treasury that the order for new Canadian coinage be increased from 50,000 pounds sterling to 70,000. A new request is made for 20,000 pounds sterling of copper for 10 million 1-cent coins. [295.200] [306.143] (1857 [46]) In England, a double set of the first two of each coin denomination struck for Canada is presented to Queen Victoria. [39.1] [662.50] The Royal Mint begins striking 1c coins for Canada. [295.200] August The first shipment of Canadian decimal coins is received in Canada from the Royal Mint. It consists of $100,000 in 20c pieces, $75,000 in 10c pieces, $75,000 in 5c pieces, and $50,000 in 1c pieces. [286.250] [306.143] [397.15] December 10 "Letters Patent" makes legal tender the silver 5c, 10c, and 20c pieces, and copper cent. [16.19] [39.1] [276.188] [277.110] [294.117] [350.91] [1080.42] December 12 The decimal coins of Canada are released. Of the order for 10 million 1-cent coins, only 421,000 1-cent coins are ready. [35.8] [380.191] [662.50] [1015.80] [1036.36] [1098.62] (September [1]) 1860 The government decides to replace the 20c piece with a 25c coin. [661.51] 1861 The government of the Province of Canada sends part of its stock of 1-cent coins to the New Brunswick for temporary use there while that colony awaited the arrival of its own coinage from England. [661.48] 1862 December 9 Canada's first coin club is formed, the Numismatic Society of Montreal, in Montreal, Quebec. Adelard Boucher is named first president. [222.71] [334.116] [350.34] [353.432] [661.v] 1866 January The name of the Numismatic Society of Montreal is changed to the Numismatic and Antiquarian Society of Montreal. [334.116] [350.35] [353.433] (January 1867 [222.71]) (Antiquarian and Numismatic Research Society of Montreal [334.116]) November An Order-in-Council makes gold coins from the Sydney Mint legal tender in Canada. [16.19] 1867 March 29 The British North America Act receives royal assent, giving legislative authority to the parliament of Canada over matters of coinage. [76.3] July The Dominion of Canada inherits a stock of several million 1c pieces from the Province of Canada, which it proceeds to issue as Dominion currency. [661.48] 1868 May 22 An Act of Canadian Parliament receives royal assent regarding the manufacture or import of copper/brass coins/tokens, making it illegal to do so unless issued under lawful authority. [77.123] An Act of Canadian Parliament receives royal assent regarding currency in Canada. Provided the Congress of the USA agrees to adopt the standards set in the International Monetary Conference, then denominations of currency in Canada would be set as pounds, shillings, pence, dollars, cents, and mills, and copper/silver/gold coins of the UK, USA, France and other countries would be legal tender in Canada. This Act also sets the value of the Canadian dollar at 1/4 of the British pound. [77.114] [276.197] 1869 June 22 An Act of Canadian Parliament receives royal assent regarding illegal coin-related offences. The Act is set to take effect as of January 1, 1870. [78.138] (month unknown) The Numismatic and Antiquarian Society of Montreal publishes Alfred Sandham's Coins, Tokens and Medals of the Dominion of Canada. It is the first work published in Canada about Canadian numismatics. [222] [336.12] [350.35] [442.18] 1870 February 12 An official proclamation sets April 15 as the last day of grace for US silver coins to circulate in Canada. [55] [350.65] [1158.50] April 15 Last day US silver coins may circulate in Canada at par. [1105.77] [1158.50] (month unknown) The first silver 5, 10, 25, and 50 cent pieces of the Dominion of Canada are issued. The general sizes and designs are the same as the issues for the Province of Canada, but the Queen's head has a crown instead of a laurel wreath. [661.66] September 9 The Finance Minister circulates a notice authorizing legally struck copper half penny tokens, and sous as cents, and one penny tokens as two cents, effective October 1. The withdrawal of the 20c piece is also initiated. [35.8] [295.199] [350.91] [361.285] [1021.28] [1055.44] October 1 Government offices officially begin accepting copper bank tokens for use as decimal coins. Half penny tokens are worth one cent, and one penny tokens are worth two cents. [172.51] [1083.22] 1871 April 14 The Uniform Currency Act receives royal assent. The Act sets denominations of currency in Canada as dollars, cents, and mills. The value of a British gold sovereign is set at $5. Silver and copper coins of other countries are no longer legal tender. Foreign gold coins may be allowed, specifically the US $10 gold (Eagle) minted after 1834, with a value set at $10. The Act is set to take effect as of July 1, 1871. [79.21] [85] [276.198] [277.110] [995.50] July 1 The Uniform Currency Act comes into effect, establishing the decimal currency system uniformly across Canada. [1] December 18 The Ralph Heaton & Sons mint strikes silver coins for the first time. 1000 1871-dated 50c pieces for Canada are made under special supervision of personnel from the Royal Mint. (The inability of the Royal Mint to completely satisfy the coinage needs of Canada is later used in arguments for a minting facility within Canada.) [350.35] [652.20] [693.6] [1154.38] 1872 The first issue of the book The Canadian Antiquarian and Numismatic Journal is published. [359.214] 1876 December 9 An Order in Council sets the 1c piece legal tender to the amount of 25 cents in any one payment. [93] [1036.36] [1080.42] [1098.62] (month unknown) The first one cent coins of the Dominion of Canada are issued. The design of the Queen on the obverse was changed from previous issues, showing the Queen wearing a crown, instead of a laurel wreath. [661.52] [521.8] 1881 April The government returns $18,000 worth of 20c pieces to the mint in England, to be melted and recoined as other pieces. [350.36] July In London, England, the original 1858 Canadian specimen double coin set owned by British Prime Minister Benjamin Disraeli is sold at auction by Christie's. [39.1] [662.50] 1882 Joseph LeRoux publishes a catalogue of Canadian coins. [350.36] 1883 Joseph LeRoux publishes the book Numismatic Atlas for Canada. [350.36] 1885 The government returns $50,000 worth of 20c pieces to England, to be melted. [350.37] 1888 The government returns $17,174 worth of 20c pieces to England, to be melted. [350.37] Joseph LeRoux publishes the book The Canadian Coin Cabinet. [359.183] 1889 The government returns $16,585 worth of 20c pieces to the Royal Mint, to be melted and recoined as 25c pieces. [337.25] [350.37]
9201
dbpedia
0
7
https://kids.kiddle.co/Coins_of_the_Newfoundland_dollar
en
Coins of the Newfoundland dollar facts for kids
https://kids.kiddle.co/i…_Token_c1840.jpg
https://kids.kiddle.co/i…_Token_c1840.jpg
[ "https://kids.kiddle.co/images/wk/kids-robot.svg", "https://kids.kiddle.co/images/wk/kids-search-engine.svg", "https://kids.kiddle.co/images/thumb/d/d9/Canada_Newfoundland_Rutherford_Penny_Token_c1840.jpg/300px-Canada_Newfoundland_Rutherford_Penny_Token_c1840.jpg", "https://kids.kiddle.co/images/thumb/4/41/Canada_Newfoundland_Victoria_1_Cent_1885.jpg/250px-Canada_Newfoundland_Victoria_1_Cent_1885.jpg", "https://kids.kiddle.co/images/thumb/a/a9/Canada_Newfoundland_Victoria_5_Cents_1870_%28Obverse_1%29.jpg/250px-Canada_Newfoundland_Victoria_5_Cents_1870_%28Obverse_1%29.jpg", "https://kids.kiddle.co/images/thumb/8/8b/Canada_Newfoundland_Victoria_10_Cents_1894.jpg/250px-Canada_Newfoundland_Victoria_10_Cents_1894.jpg", "https://kids.kiddle.co/images/thumb/3/3f/Canada_Newfoundland_Victoria_20_Cents_1894_%28Obverse_2%29.jpg/250px-Canada_Newfoundland_Victoria_20_Cents_1894_%28Obverse_2%29.jpg", "https://kids.kiddle.co/images/thumb/a/a7/Canada_Newfoundland_Victoria_50_Cents_1882-H.jpg/250px-Canada_Newfoundland_Victoria_50_Cents_1882-H.jpg", "https://kids.kiddle.co/images/thumb/e/e2/Canada_Newfoundland_Victoria_gold_2_Dollars_1870.jpg/250px-Canada_Newfoundland_Victoria_gold_2_Dollars_1870.jpg", "https://kids.kiddle.co/images/thumb/f/ff/Canada_Newfoundland_Edward_VII_1_Cent_1904H.jpg/250px-Canada_Newfoundland_Edward_VII_1_Cent_1904H.jpg", "https://kids.kiddle.co/images/thumb/0/0f/Canada_Newfoundland_Edward_VII_5_Cents_1903.jpg/250px-Canada_Newfoundland_Edward_VII_5_Cents_1903.jpg", "https://kids.kiddle.co/images/thumb/b/bf/Canada_Newfoundland_Edward_VII_10_Cents_1904H.jpg/250px-Canada_Newfoundland_Edward_VII_10_Cents_1904H.jpg", "https://kids.kiddle.co/images/thumb/e/e2/Canada_Newfoundland_Edward_VII_20_Cents_1904H.jpg/250px-Canada_Newfoundland_Edward_VII_20_Cents_1904H.jpg", "https://kids.kiddle.co/images/thumb/f/f7/Canada_Newfoundland_Edward_VII_50_Cents_1908.jpg/250px-Canada_Newfoundland_Edward_VII_50_Cents_1908.jpg", "https://kids.kiddle.co/images/thumb/5/54/Canada_Newfoundland_George_V_1_Cent_1936.jpg/250px-Canada_Newfoundland_George_V_1_Cent_1936.jpg", "https://kids.kiddle.co/images/thumb/e/e4/Canada_Newfoundland_George_V_5_Cents_1912.jpg/250px-Canada_Newfoundland_George_V_5_Cents_1912.jpg", "https://kids.kiddle.co/images/thumb/5/5a/Canada_Newfoundland_George_V_10_Cents_1912.jpg/250px-Canada_Newfoundland_George_V_10_Cents_1912.jpg", "https://kids.kiddle.co/images/thumb/c/c8/Canada_Newfoundland_George_V_20_Cents_1912.jpg/250px-Canada_Newfoundland_George_V_20_Cents_1912.jpg", "https://kids.kiddle.co/images/thumb/1/14/Canada_Newfoundland_George_V_25_Cents_1917C.jpg/250px-Canada_Newfoundland_George_V_25_Cents_1917C.jpg", "https://kids.kiddle.co/images/thumb/b/bf/Canada_Newfoundland_George_V_50_Cents_1917C.jpg/250px-Canada_Newfoundland_George_V_50_Cents_1917C.jpg", "https://kids.kiddle.co/images/thumb/6/69/Canada_Newfoundland_George_VI_1_Cent_1942.jpg/250px-Canada_Newfoundland_George_VI_1_Cent_1942.jpg", "https://kids.kiddle.co/images/thumb/f/fe/Canada_Newfoundland_George_VI_5_Cents_1941C.jpg/250px-Canada_Newfoundland_George_VI_5_Cents_1941C.jpg", "https://kids.kiddle.co/images/thumb/c/c2/Canada_Newfoundland_George_VI_10_Cents_1941C.jpg/250px-Canada_Newfoundland_George_VI_10_Cents_1941C.jpg", "https://kids.kiddle.co/images/wk/kids-search-engine.svg" ]
[]
[]
[ "" ]
null
[]
null
Learn Coins of the Newfoundland dollar facts for kids
en
/images/wk/favicon-16x16.png
https://kids.kiddle.co/Coins_of_the_Newfoundland_dollar
See also: Newfoundland dollar Newfoundland, as a separate British colony, produced its own decimal currency between 1865 and 1947. The coins of Newfoundland are of historical importance as Newfoundland was a British colony until 1907, and a Dominion until 1949, when Newfoundland and Labrador became the tenth province of Canada. Traders' tokens Rutherford brothers The first Newfoundland traders' tokens were Halfpenny tokens issued by brothers Robert & I.S. Rutherford in St John's in 1840–41. There are two varieties of the tokens – a dated type and an undated type. In 1846, after a fire destroyed the St. John's store, two additional Rutherford Brothers (George and Andrew) opened a new store in Harbour Grace and issued a second set of tokens, inscribed RUTHERFORD BROS. These pieces were minted by Ralph Heaton & Sons of Birmingham, England (commonly known as Heaton's Mint). These pieces are unique in one respect – they have the 'RH' mintmark above the date. The Peter M'Auslane farthing Another early Newfoundland traders' token was issued in the 1840s by Peter M'Auslane, a general merchant in St John's. Following the same 1846 St. John's fire which destroyed his business, he left Newfoundland and settled in Upper Canada (now Ontario). The obverse of this very rare piece is inscribed 'PETER M'AUSLANE St. JOHNS NEWFOUNDLAND', and the reverse is inscribed 'SELLS ALL SORTS OF SHOP & STORE GOODS'. Anonymous issues These pieces do not bear either an issuer's name or a place name. There were two issues of these pieces: a Halfpenny dated 1858 and a Halfpenny dated 1860. The 1858 Halfpenny token, which is very rare, has a ship on the obverse similar to the Ship Halfpenny tokens from Prince Edward Island. The date 1858 alone appears across the centre of the reverse. The 1860 Halfpenny token, which is scarce has the date 1860 in the centre of the obverse inside a circle. The inscription FISHERY RIGHTS FOR NEWFOUNDLAND is enclosed outside the inner circle. The reverse of this piece is inscribed RESPONSIBLE GOVERNMENT going around the outside and AND FREE TRADE is in the centre of the reverse. This piece makes a political statement on promoting the fishing industry and asserting a claim to responsible government. Newfoundland dollar coinage (1865–1947) In 1865, Newfoundland changed over to decimal currency following the footsteps of Canada, New Brunswick, and Nova Scotia. Pattern coins were issued in 1864, as were specimen cents. Newfoundland was the only British North American colony to have its own gold coin (though the Ottawa mint also produced gold sovereigns). Originally, a gold dollar was considered, but it was decided it might be lost by the fishermen due to its small size. Thus, a two-dollar denomination was chosen for the gold coin. Three (equivalent) denominations were indicated on the coin, as it was denominated as $2, 200 cents, and 100 pence (equivalent value in sterling). One thing that differentiates the later versions of the dollar coins is that they feature the crowned Percy Metcalfe effigy of King George VI. Usually, this portrait is used for Crown colonies such as Hong Kong, Malaya, or India, whereas for normal Canadian coins, an uncrowned effigy of the King by Thomas Humphrey Paget is used. Complete type set of Newfoundland dollar coinage
9201
dbpedia
1
37
https://cartolina.com/products/cartolina-vintage-map-of-the-dominion-of-canada-and-newfoundland
en
Cartolina Vintage Map of the Dominion of Canada and Newfoundland
http://cartolina.com/cdn/shop/products/a8f27c02-4bdb-43ea-bece-356c3e10f32a_600x.jpg?v=1610824464
http://cartolina.com/cdn/shop/products/a8f27c02-4bdb-43ea-bece-356c3e10f32a_600x.jpg?v=1610824464
[ "https://cartolina.com/cdn/shop/files/new_logo_410x.jpg?v=1618683835", "https://cartolina.com/cdn/shop/files/new_logo_410x.jpg?v=1618683835", "https://cartolina.com/cdn/shop/files/new_logo_410x.jpg?v=1618683835", "https://cartolina.com/cdn/shop/products/a8f27c02-4bdb-43ea-bece-356c3e10f32a_5000x.jpg?v=1610824464", "https://cartolina.com/cdn/shop/products/a8f27c02-4bdb-43ea-bece-356c3e10f32a_1200x.jpg?v=1610824464", "https://cartolina.com/cdn/shop/files/New_Cartolina_logo_500x500.png?v=1615319708" ]
[]
[]
[ "" ]
null
[]
null
This vintage map of the Dominion of Canada and Newfoundland is colourful, beautiful, and so interesting!  Printed on heavy paper. 20"H x 28"W Please note: A maximum of 3 maps can fit in each mailing tube for the flat rate of $16.
en
//cartolina.com/cdn/shop/t/13/assets/favicon.png?v=148718616098839658131632801035
Cartolina
https://cartolina.com/products/cartolina-vintage-map-of-the-dominion-of-canada-and-newfoundland
This vintage map of the Dominion of Canada and Newfoundland is colourful, beautiful, and so interesting! Printed on heavy paper. 20"H x 28"W
9201
dbpedia
3
55
https://althistory.fandom.com/wiki/Newfoundland_and_Labrador_(Clingy_Britain)
en
Newfoundland and Labrador (Clingy Britain)
https://static.wikia.nocookie.net/althistory/images/3/32/Europemax01.gif/revision/latest?cb=20140612141224
https://static.wikia.nocookie.net/althistory/images/3/32/Europemax01.gif/revision/latest?cb=20140612141224
[ "https://static.wikia.nocookie.net/althistory/images/e/e6/Site-logo.png/revision/latest?cb=20210916044045", "https://static.wikia.nocookie.net/althistory/images/e/e6/Site-logo.png/revision/latest?cb=20210916044045", "https://static.wikia.nocookie.net/althistory/images/d/dd/Flag_of_Newfoundland_and_Labrador.svg/revision/latest/scale-to-width-down/180?cb=20230204115029", "https://static.wikia.nocookie.net/althistory/images/3/32/Europemax01.gif/revision/latest/scale-to-width-down/220?cb=20140612141224", "https://static.wikia.nocookie.net/althistory/images/3/3d/New_Bitmap_Image_%282%29-0.PNG/revision/latest/scale-to-width-down/232?cb=20140625141929", "https://static.wikia.nocookie.net/6a181c72-e8bf-419b-b4db-18fd56a0eb60", "https://static.wikia.nocookie.net/6c42ce6a-b205-41f5-82c6-5011721932e7", "https://static.wikia.nocookie.net/464fc70a-5090-490b-b47e-0759e89c263f", "https://static.wikia.nocookie.net/f7bb9d33-4f9a-4faa-88fe-2a0bd8138668" ]
[]
[]
[ "" ]
null
[ "Contributors to Alternative History" ]
null
Newfoundland and Labrador is the largest oversea division of the UK, encompassing 405,212 sq km (including territorial waters). It has a total population of over 500,000, around 40% of whom live in the capital of St. John's. The former colony has its own parliament and acts independently of UK...
en
https://static.wikia.nocookie.net/althistory/images/4/4a/Site-favicon.ico/revision/latest?cb=20210916203836
Alternative History
https://althistory.fandom.com/wiki/Newfoundland_and_Labrador_(Clingy_Britain)
Newfoundland and Labrador is the largest oversea division of the UK, encompassing 405,212 sq km (including territorial waters). It has a total population of over 500,000, around 40% of whom live in the capital of St. John's. The former colony has its own parliament and acts independently of UK proper on most issues. History[] Newfoundland and Labrador was first inhabited by native Americans around 9000 years ago and developed their own cultures and languages. In 1001 AD Viking explorer Leif Ericson landed in the area and established a small settlement on Newfoundland (then referred to as Vinland), however the settlement collapsed soon after its establishment. In 1497 AD, English explorer John Cabot landed on the Island and proclaimed it as English territory. Over the years Newfoundland became a major colony in the British empire (even more so after the loss of the Thirteen colonies). In 1854 the colony voted to form a responsible government instead of joining the dominion of Canada, becoming a dominion itself in 1907. However during the great depression the dominion accumulated massive amounts of debt forcing the government to be absorbed into the UK to pay of its debts in 1948, before regaining its self autonomy in 1950 as an overseas division of the UK. In 1980 the flag was changed to represent the more equal status the Division had to UK proper. Economy[] The economy of Newfoundland and Labrador was primarily based on its booming fishing industry up until the 1990's when overfishing lead to the a harsh decline. This decline lead to record levels of unemployment and emigration to Canada. However, this economic decline was offset by the divisions growing service and mining industries which helped to lead to the division's reduced unemployment rate and stabilised its economy in the mid 2000's. Politics[] Newfoundland and Labrador is a constitutional monarchy, with The parliament of Newfoundland and Labrador being the highest political power in the division other than the British parliament. The parliament is made up of 50 seats split between several major parties. Newfoundland and Labrador also make up seven seats in the British parliament. Active parties[] Newfoundland and Labrador Labour party (NLLP): A center-left party which is the largest party in the division, both by number of votes and number of seats held. It is also the largest Unionist party (a party which supports remaining part of the UK) and often receives most of the Unionist votes. It holds 20 of the 50 seats in the Newfoundland parliament and three of the seven seats in the British parliament. Liberal party of Newfoundland (LPN): A center-right party which acts as the main opposition to the Labour party. It is the largest Conferderist party (a party which supports becoming part of Canada) and thus receives most of the Conferderist votes. It holds 18 of the 50 seats in the Newfoundland parliament and two of the seven seats in the British parliament. Conservative party of Newfoundland (CPN): A right wing party which was formed to prevent the increasing power of left wing parties in power. It is the second largest Unionist party though most of the Unionist votes go to the Labour party. It holds five of the 25 seats in the Newfoundland parliament and one seat in the British parliament. Green party of Labrador (GPL): A left wing party which has a strong view on green politics. It is the second largest Conferderist party in the division though receives few Conferderist votes. It is one of the youngest and fastest growing parties. Is holds three of the 50 seats in the Newfoundland parliament and one seat in the British parliament. Progressive Conservative Union (PCU): A splitter group from the CPN after the several disputes. It makes three seats in the Newfoundland parliament but no seats in the British parliament. Fisherman's Protective Union (FPU): A left wing party which main aims are protecting the interests of the fishing industry in the division. It is a Unionist party. However, it doesn't use that fact to attempt to increase the number of votes it receives, which have taken a sharp decline after many Fishing industries went bust in the mid-90's. It holds one of the 50 seats in the Newfoundland parliament but no seats in the British parliament. Defunct parties[] United Newfoundland party (UNP): a right wing conservative party that merged with the Conservative Party after losing all but one of its seats in the Newfoundland parliament.
9201
dbpedia
0
16
https://www.worldbanknotescoins.com/2014/12/1920-government-of-newfoundland-1-dollar-bill.html
en
World Banknotes & Coins Pictures | Old Money, Foreign Currency Notes, World Paper Money Museum
https://blogger.googleus…+Dollar+Bill.JPG
https://blogger.googleus…+Dollar+Bill.JPG
[ "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiq01VDBGQg4HFu9nr0yqr4DuyzUpD1j0lU66EM_bFoz-DRbIoS7Y-xHYf7JwL8_KydF1y9e-k7ABek4lRF2HrB1fJntwg1hEVt81DS_WQyz2sd6BoQAG_C3pxW6RBRTiu1nREYZqWcR3O8/s1600/1920+Newfoundland+one+Dollar+Bill.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiXN3aAX1yqqYL2KWld9OXlZGkS-rI5IJWrHlCE5skk2DQnfQ7-6oun6la6Y6EUqpys3PuXfHLyE5d85m_Q1h0_bRokWaB7MSMEWETG8vd04o4C_s7ASAr1yThayDFSzC2oG8dd3BqY_DvI/s1600/1920+Government+of+Newfoundland+$1+Dollar+Bill.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixFIQ2N6Ue0hctVRZIVNUspdXyE18XQi_NJkj9vZvvWn4rlz4JCBjK33E_iu5GA3UCl67NvNKi1azyyFMxiBmCrPYDCr36rcFk-HIrMHuNHAQ_2nh-sb8OPZ3dmUNzbUTcHF-b910oMo2S/s72-c/$5000+Federal+Reserve+Note.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixFIQ2N6Ue0hctVRZIVNUspdXyE18XQi_NJkj9vZvvWn4rlz4JCBjK33E_iu5GA3UCl67NvNKi1azyyFMxiBmCrPYDCr36rcFk-HIrMHuNHAQ_2nh-sb8OPZ3dmUNzbUTcHF-b910oMo2S/s72-c/$5000+Federal+Reserve+Note.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixFIQ2N6Ue0hctVRZIVNUspdXyE18XQi_NJkj9vZvvWn4rlz4JCBjK33E_iu5GA3UCl67NvNKi1azyyFMxiBmCrPYDCr36rcFk-HIrMHuNHAQ_2nh-sb8OPZ3dmUNzbUTcHF-b910oMo2S/s72-c/$5000+Federal+Reserve+Note.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhyHMtuKTGbINI2XBWslQndXuR6pE1ojHIRYxWBP-D1yIKYCqSsha8myEJ_T74tkxm3bjdEnybBrZQ8HkkIupc2XW1qrG1jFh_xNaD2_QytaBNNo4shRUvzMulVROqi2z5t6JhSwjM9tFk/s72-c/England+50+Pound+Sterling+note+2011.JPG", "https://4.bp.blogspot.com/-CNv2AeLG1Rs/UKqjDtjDbNI/AAAAAAAAKlI/mUbrMsfdvTI/s72-c/ENGLAND+%25C2%25A350+British+Pounds+Sterlings%252C+Queen+Elizabeth.jpg", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiAOrDTTwupndwi_nC3TvxcOFCxglT6feriNi4cgQ-jXh34TJly32m9xuuj_fbTyyAOusr9ZZ-xTk7ku1Gdw8aldfMg0uPMB7M5qnRrS8ve6w6mINnaaGHHFaEno6ZDstFCDjthr_YTOJg/s72-c/England+20+Pound+Sterling+note+1999.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjFuwbxBazeBZ8ueZb_gr2CbQs0Sdjp8IsRLkDMAQh8EBaVG8BYTFqoaQNuz-wGZQU126ewu2zoDQQw4WgAW5oUM4ZNnBaeYGHpPfxxe4n6Yuz6jkYbseO5rerkVyrAa01ASOGePfsHf8s/s72-c/England+5+Pound+Sterling+note+2002.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiofii4Hwt_cvODzKI8XIPJ1Eji6TRZtCZ7qCEJKYtNYdrSgiJLORqOoVcme5Ln6mmJmUkISkhdY0CVJTPnAGeu2I8onZ9sc607wP4rcQv-dNULqSHkFuUVVrGl1B2HgJSyDsCdriIVoDY/s72-c/England+20+Pound+Sterling+note+1993.JPG", "https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh3xVs4YB4EzcARPtNtrb-8n8zdjnbG49831JvVYGs7s_w-FipxjDBvLWj7-HL_LsuSnZAyugePsejSVtidiMXj1HiSZBvBKYfS46aTLSfperWI1fMNmNhYpP5HDJRjCw-nWI8TQeaNXq8/s72-c/Canada+1000+Dollars+banknote+1988+Queen+Elizabeth+II.JPG", "https://4.bp.blogspot.com/-n-AK3xcVzCo/U-fmnv2-Q3I/AAAAAAAAB1M/0kkYDZZSyAw/s72-c/Singapore+10000+Dollars+banknote+Orchid+Series.jpg", "https://1.bp.blogspot.com/-x-jeMURzpec/UzX-VUN1nlI/AAAAAAAAAd0/IBm_f2xkaBY/s72-c/Commemorative+2+euro+coins+Greece+2013.jpg" ]
[]
[]
[ "" ]
null
[]
null
Newfoundland dollar January 2nd 1920 Government of Newfoundland $1 Bill 1920 Government of Newfoundland $1 Dollar Bill Obverse: ...
https://www.worldbanknotescoins.com/favicon.ico
https://www.worldbanknotescoins.com/2014/12/1920-government-of-newfoundland-1-dollar-bill.html
World Banknotes and Coins, Foreign Currency from Around the World. Old Money, Currency Notes. World Banknote Gallery - Huge collection of world banknotes images pictures with description and tons of information about World Paper Money.
9201
dbpedia
3
0
https://en.wikipedia.org/wiki/Dominion_of_Newfoundland
en
Dominion of Newfoundland
https://upload.wikimedia…d_Ensign.svg.png
https://upload.wikimedia…d_Ensign.svg.png
[ "https://en.wikipedia.org/static/images/icons/wikipedia.png", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-wordmark-en.svg", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-tagline-en.svg", "https://upload.wikimedia.org/wikipedia/commons/thumb/d/d2/Dominion_of_Newfoundland_Red_Ensign.svg/125px-Dominion_of_Newfoundland_Red_Ensign.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/53/Coat_of_Arms_of_Newfoundland_and_Labrador.svg/85px-Coat_of_Arms_of_Newfoundland_and_Labrador.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/67/Dominionofnewfoundlandlocation.PNG/250px-Dominionofnewfoundlandlocation.PNG", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/5e/Flag_of_Newfoundland_%281870%E2%80%931904%29.svg/20px-Flag_of_Newfoundland_%281870%E2%80%931904%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/6d/Flag_of_Canada_%281921%E2%80%931957%29.svg/20px-Flag_of_Canada_%281921%E2%80%931957%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/a/a5/Flag_of_the_United_Kingdom_%281-2%29.svg/20px-Flag_of_the_United_Kingdom_%281-2%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/5e/Flag_of_Newfoundland_%281870%E2%80%931904%29.svg/175px-Flag_of_Newfoundland_%281870%E2%80%931904%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/d/d2/Dominion_of_Newfoundland_Red_Ensign.svg/175px-Dominion_of_Newfoundland_Red_Ensign.svg.png", "https://upload.wikimedia.org/wikipedia/en/thumb/a/ae/Flag_of_the_United_Kingdom.svg/175px-Flag_of_the_United_Kingdom.svg.png", "https://upload.wikimedia.org/wikipedia/en/thumb/9/99/Question_book-new.svg/50px-Question_book-new.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/d/d9/NFL_in_1912.png/180px-NFL_in_1912.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/a/af/Colonial_Building%2C_St._John%27s%2C_Canada.jpg/220px-Colonial_Building%2C_St._John%27s%2C_Canada.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/6b/Newfoundland_passport.jpg/220px-Newfoundland_passport.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/53/NFLD_dollar_bill.jpg/350px-NFLD_dollar_bill.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/2/2d/Humphrey_Gilbert_Stamp.jpg/180px-Humphrey_Gilbert_Stamp.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/2/25/NL-Canada-province.png/120px-NL-Canada-province.png", "https://upload.wikimedia.org/wikipedia/en/thumb/9/96/Symbol_category_class.svg/16px-Symbol_category_class.svg.png", "https://upload.wikimedia.org/wikipedia/en/thumb/e/e2/Symbol_portal_class.svg/16px-Symbol_portal_class.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/3/37/People_icon.svg/16px-People_icon.svg.png", "https://upload.wikimedia.org/wikipedia/en/thumb/9/96/Symbol_category_class.svg/16px-Symbol_category_class.svg.png", "https://upload.wikimedia.org/wikipedia/en/thumb/e/e2/Symbol_portal_class.svg/16px-Symbol_portal_class.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/6e/Imperial_Crown_Heraldry.svg/20px-Imperial_Crown_Heraldry.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/f/fc/Maple_Leaf_%28from_roundel%29.svg/17px-Maple_Leaf_%28from_roundel%29.svg.png", "https://upload.wikimedia.org/wikipedia/en/thumb/8/8a/OOjs_UI_icon_edit-ltr-progressive.svg/10px-OOjs_UI_icon_edit-ltr-progressive.svg.png", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://en.wikipedia.org/static/images/footer/wikimedia-button.svg", "https://en.wikipedia.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[ "Contributors to Wikimedia projects" ]
2004-06-01T23:09:31+00:00
en
/static/apple-touch/wikipedia.png
https://en.wikipedia.org/wiki/Dominion_of_Newfoundland
British dominion from 1907 to 1949 Newfoundland was a British dominion in eastern North America, today the modern Canadian province of Newfoundland and Labrador. It was confirmed by the Balfour Declaration of 1926 and the Statute of Westminster of 1931. It included the island of Newfoundland, and Labrador on the continental mainland. Newfoundland was one of the original dominions within the meaning of the Balfour Declaration, and accordingly enjoyed a constitutional status equivalent to the other dominions of the time. In 1934, Newfoundland became the only dominion to give up its self-governing status, which ended 79 years of self-government.[1] The abolition of self-government came about because of a crisis in Newfoundland's public finances in 1932. Newfoundland had accumulated a significant amount of debt by building a railway across the island, which was completed in the 1890s, and by raising its own regiment during the First World War.[1] In November 1932, the government warned that Newfoundland would default on payments on the public debt.[1] The British government quickly established the Newfoundland Royal Commission to inquire into and report on the position.[1] The commission's report, published in October 1933, recommended that Newfoundland give up self-government temporarily and allow the United Kingdom to administer it by an appointed commission.[1] The Newfoundland parliament accepted the recommendations and presented a petition to the King to ask for the suspension of the constitution and the appointment of commissioners to administer the government until the country became self-supporting again. To enable compliance with the request, the British Parliament passed the Newfoundland Act 1933, and on 16 February 1934, the British government appointed six commissioners, three from Newfoundland and three from the United Kingdom, with the governor as chairman. The system of a six-member Commission of Government continued to govern Newfoundland until Newfoundland joined Canada in 1949 to become Canada's tenth province.[3] Etymology and national symbols [edit] The official name of the dominion was "Newfoundland" and not, as was sometimes reported, "Dominion of Newfoundland". The distinction is apparent in many statutes, most notably the Statute of Westminster that listed the full name of each realm, including the "Dominion of New Zealand", the "Dominion of Canada", and "Newfoundland".[4] The Newfoundland Blue Ensign was used as the colonial flag from 1870 to 1904. The Newfoundland Red Ensign was used as the de facto national flag of the dominion[5] until the legislature adopted the Union Flag on 15 May 1931. The anthem of the dominion was the "Ode to Newfoundland", written by British colonial governor Sir Cavendish Boyle in 1902 during his administration of Newfoundland (1901 to 1904).[6] It was adopted as the dominion's anthem on 20 May 1904, until confederation with Canada in 1949. In 1980, the province of Newfoundland re-adopted the song as a provincial anthem. The "Ode to Newfoundland" continues to be heard at public events in the province; however, only the first and last verses are traditionally sung. Political origins [edit] The remaining North American colonies (the Province of Canada - previously Upper Canada and Lower Canada; Colony of Newfoundland; Nova Scotia; New Brunswick; Prince Edward Island; Rupert's Land; British Arctic Territories; Columbia District/Oregon Country - shared with the United States; and Bermuda), after the 1783 independence of the thirteen that became the United States of America, were administered collectively within the British Empire as British North America. From 1824, the British Empire was divided by the War and Colonial Office into four administrative departments, including North America, which was made up of:[7] Upper Canada, Lower Canada New Brunswick, Nova Scotia, Prince Edward Island Bermuda, Newfoundland In 1854, the British government established Newfoundland's responsible government.[8] In 1855, Philip Francis Little, a native of Prince Edward Island, won a parliamentary majority over Sir Hugh Hoyles and the Conservatives. Little formed the first administration from 1855 to 1858. Under the 1867 Confederation of Canada, all except Newfoundland and Bermuda confederated to form the Dominion of Canada. Newfoundland rejected confederation with Canada in the 1869 general election. Sir John Thompson, Prime Minister of Canada, came very close to negotiating Newfoundland's entry into Confederation in 1892. It remained a colony until the 1907 Imperial Conference resolved to confer dominion status on all self-governing colonies in attendance.[9] The annual holiday of Dominion Day was celebrated each 26 September to commemorate the occasion. First World War and afterwards [edit] Newfoundland's own regiment, the 1st Newfoundland Regiment, fought in the First World War. On 1 July 1916, the German Army wiped out most of that regiment at Beaumont Hamel on the first day on the Somme, inflicting 90 percent casualties.[page needed] Yet the regiment went on to serve with distinction in several subsequent battles, earning the prefix "Royal". Despite people's pride in the accomplishments of the regiment, Newfoundland's war debt and pension responsibility for the regiment and the cost of maintaining a trans-island railway led to increased and ultimately unsustainable government debt in the post-war era.[11] After the war, Newfoundland along with the other dominions sent a separate delegation to the Paris Peace Conference but, unlike the other dominions, Newfoundland neither signed the Treaty of Versailles in her own right nor sought separate membership in the League of Nations. In the 1920s, political scandals wracked the dominion. In 1923, the attorney general arrested Newfoundland's prime minister, Sir Richard Squires, on charges of corruption. Despite his release soon after on bail, a commission of enquiry, headed by Thomas Hollis-Walker, reviewed the scandal. Soon after, the Squires government fell. Squires returned to power in 1928 because of the unpopularity of his successors, the pro-business Walter Stanley Monroe and (briefly) Frederick C. Alderdice (Monroe's cousin), but found himself governing a country suffering from the Great Depression. The Judicial Committee of the Privy Council resolved Newfoundland's long-standing Labrador boundary dispute with Canada to the satisfaction of Newfoundland and against Canada (and, in particular, contrary to the wishes of Quebec, the province that bordered Labrador) with a ruling on 1 April 1927. Prior to 1867, the Quebec North Shore portion of the "Labrador coast" had shuttled back and forth between the colonies of Lower Canada and Newfoundland. Maps up to 1927 showed the coastal region as part of Newfoundland, with an undefined boundary. The Privy Council ruling established a boundary along the drainage divide separating waters that flowed through the territory to the Labrador coast, although following two straight lines from the Romaine River along the 52nd parallel, then south near 57 degrees west longitude to the Gulf of Saint Lawrence. Quebec has long rejected the outcome, and Quebec's provincially issued maps do not mark the boundary in the same way as boundaries with Ontario and New Brunswick. Newfoundland only gradually implemented its status as a self-governing dominion. In 1921, it officially established the position of High Commissioner to the United Kingdom (for which Sir Edgar Rennie Bowring had already assumed the role in 1918),[12] and it adopted a national flag and established an external affairs department in 1931,[13][14] after it had given its assent for the passage of the Statute of Westminster 1931.[15] End of responsible government [edit] As a small country which relied primarily upon the export of fish, paper, and minerals, Newfoundland was hit hard by the Great Depression. Economic frustration combined with anger over government corruption led to a general dissatisfaction with democratic government. On 5 April 1932, a crowd of 10,000 people marched on the Colonial Building (seat of the House of Assembly) and forced Prime Minister Squires to flee. Squires lost an election held later in 1932. The next government, led once more by Alderdice, called upon the British government to take direct control until Newfoundland could become self-sustaining. The United Kingdom, concerned over Newfoundland's likelihood of defaulting on its war-debt payments, established the Newfoundland Royal Commission, headed by a Scottish peer, Lord Amulree. Its report, released in 1933, assessed Newfoundland's political culture as intrinsically corrupt and its economic prospects as bleak, and advocated the abolition of responsible government and its replacement by a Commission of the British Government. Acting on the report's recommendations, Alderdice's government voted itself out of existence in December 1933.[1] In 1934, the Dominion suspended Newfoundland's self-governing status and the Commission of Government took control. Newfoundland remained a dominion in name only.[16] Newfoundland was ruled by a governor who reported to the Colonial Secretary in London. The legislature was suspended. The severe worldwide Great Depression persisted until the Second World War broke out in 1939. Second World War [edit] Given Newfoundland's strategic location in the Battle of the Atlantic, the Allies (especially the United States of America) built many military bases there. Large numbers of unskilled men gained the first paycheques they had seen in years by working on construction and in dockside crews. National income doubled as an economic boom took place in the Avalon Peninsula and to a lesser degree in Gander, Botwood, and Stephenville. The United States became the main supplier, and American money and influence diffused rapidly from the military, naval, and air bases. Prosperity returned to the fishing industry by 1943. Government revenues, aided by inflation and new income, quadrupled, even though Newfoundland had tax rates much lower than those in Canada, Britain, or the United States. To the astonishment of all, Newfoundland started financing loans to London. Wartime prosperity ended the long depression and reopened the question of political status. The American Bases Act became law in Newfoundland on 11 June 1941, with American personnel creating drastic social change on the island. This included significant intermarriage between Newfoundland women and American personnel.[page needed] In October 1943, the weather station Kurt was erected in Newfoundland, marking Nazi Germany's only armed operation on land in North America. A new political party formed in Newfoundland to support closer ties with the US, the Economic Union Party, which Karl McNeil Earle characterizes as "a short-lived but lively movement for economic union with the United States". Advocates of union with Canada denounced the Economic Union Party as republican, disloyal and anti-British. No American initiative for union was ever created.[page needed] National Convention and referendums [edit] Main article: Newfoundland referendums, 1948 As soon as prosperity returned during the war, agitation began to end the commission.[page needed] Newfoundland, with a population of 313,000 (plus 5,200 in Labrador), seemed too small to be independent.[full citation needed] In 1945, London announced that a Newfoundland National Convention would be elected to advise on what constitutional choices should be voted on by referendum. Union with the United States was a possibility, but Britain rejected the option and offered instead two options: return to dominion status or continuation of the unpopular Commission.[page needed] Canada cooperated with Britain to ensure that the option of closer ties with America was not on the referendum.[citation needed] In 1946, an election took place to determine the membership of the Newfoundland National Convention, charged with deciding the future of Newfoundland. The Convention voted to hold a referendum to decide between continuing the Commission of Government or restoring responsible government. Joey Smallwood was a well-known radio personality, writer, organizer, and nationalist who had long criticized British rule. He became the leader of the confederates and moved for the inclusion of a third option – that of confederation with Canada. The Convention defeated his motion, but he did not give up, instead gathering more than 5,000 petition signatures within a fortnight, which he sent to London through the governor. Britain insisted that it would not give Newfoundland any further financial assistance, but added this third option of having Newfoundland join Canada to the ballot. After much debate, the first referendum took place on 3 June 1948, to decide between continuing with the Commission of Government, reverting to dominion status, or joining Canadian Confederation. Three parties participated in the referendum campaign: Smallwood's Confederate Association campaigned for the confederation option while in the anti-confederation campaign Peter Cashin's Responsible Government League and Chesley Crosbie's Economic Union Party (both of which called for a vote for responsible government) took part. No party advocated petitioning Britain to continue the Commission of Government. Canada had issued an invitation to join it on generous financial terms. Smallwood was the leading proponent of confederation with Canada, insisting, "Today we are more disposed to feel that our very manhood, our very creation by God, entitles us to standards of life no lower than our brothers on the mainland." Due to persistence, he succeeded in having the Canada option on the referendum.[page needed] His main opponents were Cashin and Crosbie. Cashin, a former finance minister, led the Responsible Government League, warning against cheap Canadian imports and the high Canadian income tax. Crosbie, a leader of the fishing industry, led the Party for Economic Union with the United States, seeking responsible government first, to be followed by closer ties with the United States, which could be a major source of capital.[full citation needed] The result proved inconclusive, with 44.5 percent supporting the restoration of dominion status, 41.1 percent for confederation with Canada, and 14.3 percent for continuing the Commission of Government. Due to no option getting at least 50 percent of the vote, a second referendum with the top two options from the first referendum was scheduled to be held on 22 July. The second referendum, on 22 July 1948, asked Newfoundlanders to choose between confederation and dominion status, and produced a vote of 52 to 48 percent for confederation. Newfoundland joined Canada in the final hours of 31 March 1949. See also [edit] Charles Jost Burchell, Canada's High Commissioner to Newfoundland, involved in negotiating union with Canada General elections in Newfoundland (pre-Confederation) High Commissioner of Newfoundland to the United Kingdom List of Newfoundland cases of the Judicial Committee of the Privy Council (pre-1949) List of political parties in Newfoundland and Labrador List of prime ministers of the Dominion of Newfoundland Political parties in the Dominion of Newfoundland [edit] Conservative parties in Newfoundland (pre-Confederation) Fisherman's Protective Union Liberal parties in Newfoundland (pre-Confederation) Newfoundland People's Party United Newfoundland Party References [edit] Bibliography [edit] Further reading [edit]
9201
dbpedia
2
39
https://hcmc.uvic.ca/confederation/en/lgHC_NFLD_1949-02-08.html
en
House of Commons, 8 February 1949, Canadian Confederation with Newfoundland
[ "https://hcmc.uvic.ca/confederation/images/eng-logo.svg", "https://hcmc.uvic.ca/confederation/portraits/ABBO2.jpg", "https://hcmc.uvic.ca/confederation/portraits/CHUR1.jpg", "https://hcmc.uvic.ca/confederation/portraits/CLAX1.jpg", "https://hcmc.uvic.ca/confederation/portraits/COCK2.jpg", "https://hcmc.uvic.ca/confederation/portraits/CRUI1.jpg", "https://hcmc.uvic.ca/confederation/portraits/DICK1.jpg", "https://hcmc.uvic.ca/confederation/portraits/DIEF1.jpg", "https://hcmc.uvic.ca/confederation/images/logos/dcb_logo_Bilingue.png", "https://hcmc.uvic.ca/confederation/portraits/DORI2.jpg", "https://hcmc.uvic.ca/confederation/portraits/DREW2.jpg", "https://hcmc.uvic.ca/confederation/portraits/FLEM1.jpg", "https://hcmc.uvic.ca/confederation/portraits/FRAS3.jpg", "https://hcmc.uvic.ca/confederation/portraits/FULT1.jpg", "https://hcmc.uvic.ca/confederation/portraits/GARS1.jpg", "https://hcmc.uvic.ca/confederation/portraits/GIBS2.jpg", "https://hcmc.uvic.ca/confederation/portraits/GREE1.jpg", "https://hcmc.uvic.ca/confederation/portraits/GREG1.jpg", "https://hcmc.uvic.ca/confederation/portraits/HACK1.jpg", "https://hcmc.uvic.ca/confederation/portraits/HANS1.jpg", "https://hcmc.uvic.ca/confederation/portraits/HARR2.jpg", "https://hcmc.uvic.ca/confederation/portraits/HAZE1.jpg", "https://hcmc.uvic.ca/confederation/portraits/JAEN1.jpg", "https://hcmc.uvic.ca/confederation/portraits/KIDD2.jpg", "https://hcmc.uvic.ca/confederation/portraits/KNIG1.jpg", "https://hcmc.uvic.ca/confederation/portraits/KNOW1.jpg", "https://hcmc.uvic.ca/confederation/portraits/MACI1.jpg", "https://hcmc.uvic.ca/confederation/portraits/MACN2.jpg", "https://hcmc.uvic.ca/confederation/portraits/MACD8.jpg", "https://hcmc.uvic.ca/confederation/portraits/MAYH1.jpg", "https://hcmc.uvic.ca/confederation/portraits/MCIV1.jpg", "https://hcmc.uvic.ca/confederation/portraits/MITC1.jpg", "https://hcmc.uvic.ca/confederation/portraits/NICH1.jpg" ]
[]
[]
[ "" ]
null
[]
null
en
null
Abbott, Douglas Charles This individual participated in: 1945: House of Commons as a representative for St. Antoine—Westmount 1949: NF House of Commons as a representative for St. Antoine—Westmount Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 29 January 1948 28 January 1949 8 February 1949 9 February 1949 Bentley, Thomas John This individual participated in: 1945: House of Commons as a representative for Swift Current 1949: NF House of Commons as a representative for Swift Current Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 9 February 1949 Brooks, Alfred Johnson This individual participated in: 1945: House of Commons as a representative for Royal 1949: NF House of Commons as a representative for Royal Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 9 February 1949 Case, Wilfrid Garfield This individual participated in: 1945: House of Commons as a representative for Grey North 1949: NF House of Commons as a representative for Grey North Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 20 April 1948 8 February 1949 Church, Thomas (Tommy) Langton This individual participated in: 1945: House of Commons as a representative for Broadview 1949: NF House of Commons as a representative for Broadview Number of times this person appears in the documents: 6 Debates and documents House of Commons debates on Newfoundland joining Confederation 25 April 1947 6 May 1947 18 March 1948 19 June 1948 7 February 1949 8 February 1949 Claxton, Brooke This individual participated in: 1945: House of Commons as a representative for St. Lawrence—St. George 1949: NF House of Commons as a representative for St. Lawrence—St. George Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 7 February 1949 8 February 1949 9 February 1949 Cockeram, Alan This individual participated in: 1945: House of Commons as a representative for York South 1949: NF House of Commons as a representative for York South Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 9 February 1949 Contributor(s), Anonymous This individual participated in: as a representative for Any context or legislature Number of times this person appears in the documents: 109 Debates and documents [no legislature found] 1876 to 1878 Alexander Morris's narrative of numbered Treaty negotiations July 1871 to October 1873 August 1874 to September 1874 April 1871 to September 1876 September 1876 to September 1877 Convention of 40 debates on Manitoba joining Confederation 29 January 1870 House of Commons debates on Manitoba joining Confederation 21 February 1870 14 March 1870 2 May 1870 House of Commons debates on Newfoundland joining Confederation 26 January 1949 28 January 1949 4 February 1949 7 February 1949 8 February 1949 9 February 1949 House of Commons debates on creating Alberta and Saskatchewan 14 April 1870 27 February 1889 22 January 1890 12 February 1890 13 February 1890 18 February 1890 20 February 1890 21 February 1890 6 May 1890 14 August 1891 25 April 1892 11 May 1892 12 May 1892 20 March 1894 16 July 1894 23 January 1896 17 February 1896 21 April 1897 18 April 1902 13 October 1903 23 March 1905 24 March 1905 28 March 1905 29 March 1905 30 March 1905 31 March 1905 3 April 1905 4 April 1905 5 April 1905 6 April 1905 28 April 1905 1 May 1905 2 May 1905 3 May 1905 8 May 1905 5 July 1905 Legislative Assemblies of Alberta and Saskatchewan 5 November 1896 13 September 1898 25 April 1899 Legislative Assembly of Assiniboia 3 May 1870 Legislative Council of British Columbia 9 March 1870 10 March 1870 17 March 1870 23 March 1870 25 March 1870 6 April 1870 National Convention of Newfoundland 10 November 1947 21 November 1947 New Brunwick Legislative Assembly debates on Confederation 16 March 1866 21 March 1866 23 March 1866 3 July 1866 21 May 1867 Nova Scotia Legislative Assembly debates on Confederation 17 April 1866 18 April 1866 Province of Canada Legislative Assembly debates on Confederation 8 February 1865 22 February 1865 23 February 1865 24 February 1865 28 February 1865 2 March 1865 3 March 1865 6 March 1865 7 March 1865 8 March 1865 10 March 1865 13 March 1865 Province of Canada Legislative Council debates on Confederation 15 February 1865 16 February 1865 17 February 1865 20 February 1865 Cruickshank, George Alexander This individual participated in: 1945: House of Commons as a representative for Fraser Valley 1949: NF House of Commons as a representative for Fraser Valley Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 28 January 1949 8 February 1949 Dickey, John Horace This individual participated in: 1949: NF House of Commons as a representative for Halifax 1945: House of Commons as a representative for Halifax Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 9 February 1949 Diefenbaker, John George This individual participated in: 1945: House of Commons as a representative for Lake Centre 1949: NF House of Commons as a representative for Lake Centre Number of times this person appears in the documents: 5 Debates and documents House of Commons debates on Newfoundland joining Confederation 4 June 1948 19 June 1948 28 January 1949 7 February 1949 8 February 1949 Dorion, Frédéric This individual participated in: 1945: House of Commons as a representative for Charlevoix—Saguenay 1949: NF House of Commons as a representative for Charlevoix—Saguenay Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 6 February 1948 11 March 1948 8 February 1949 9 February 1949 Drew, George Alexander This individual participated in: 1945: House of Commons as a representative for Carleton 1949: NF House of Commons as a representative for Carleton Number of times this person appears in the documents: 7 Debates and documents House of Commons debates on Newfoundland joining Confederation 26 January 1949 27 January 1949 28 January 1949 4 February 1949 7 February 1949 8 February 1949 9 February 1949 Fleming, Donald Methuen This individual participated in: 1945: House of Commons as a representative for Eglinton 1949: NF House of Commons as a representative for Eglinton Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 28 January 1949 8 February 1949 9 February 1949 Fraser, Gordon Knapman This individual participated in: 1945: House of Commons as a representative for Peterborough West 1949: NF House of Commons as a representative for Peterborough West Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 29 January 1948 28 January 1949 8 February 1949 Fulton, Edmund Davie This individual participated in: 1945: House of Commons as a representative for Kamloops 1949: NF House of Commons as a representative for Kamloops Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 18 March 1948 7 February 1949 8 February 1949 Garson, Stuart Sinclair This individual participated in: 1948: House of Commons as a representative for Marquette 1949: NF House of Commons as a representative for Marquette Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 28 January 1949 4 February 1949 7 February 1949 8 February 1949 Gibson, John Lambert This individual participated in: 1945: House of Commons as a representative for Comox—Alberni 1949: NF House of Commons as a representative for Comox–Alberni Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 7 February 1949 8 February 1949 9 February 1949 Graydon, Gordon This individual participated in: 1945: House of Commons as a representative for Peel 1949: NF House of Commons as a representative for Peel Number of times this person appears in the documents: 6 Debates and documents House of Commons debates on Newfoundland joining Confederation 29 January 1948 26 January 1949 28 January 1949 7 February 1949 8 February 1949 9 February 1949 Green, Howard Charles This individual participated in: 1945: House of Commons as a representative for Vancouver South 1949: NF House of Commons as a representative for Vancouver South Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 28 January 1949 7 February 1949 8 February 1949 9 February 1949 Gregg, Milton Fowler (Brigadier) This individual participated in: 1945: House of Commons as a representative for York—Sunbury 1949: NF House of Commons as a representative for York—Sunbury Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 7 February 1949 8 February 1949 Hackett, John Thomas This individual participated in: 1945: House of Commons as a representative for Stanstead 1949: NF House of Commons as a representative for Stanstead Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 19 June 1948 8 February 1949 Hansell, Ernest George This individual participated in: 1945: House of Commons as a representative for Macleod 1949: NF House of Commons as a representative for Macleod Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Harris, Walter Edward This individual participated in: 1945: House of Commons as a representative for Grey—Bruce 1949: NF House of Commons as a representative for Grey—Bruce Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Hazen, Douglas King This individual participated in: 1945: House of Commons as a representative for St. John—Albert 1949: NF House of Commons as a representative for St. John—Albert Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 25 April 1947 6 February 1948 8 February 1949 9 February 1949 Jaenicke, Frank Eric This individual participated in: 1945: House of Commons as a representative for Kindersley 1949: NF House of Commons as a representative for Kindersley Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Kidd, Thomas Ashmore This individual participated in: 1945: House of Commons as a representative for Kingston City 1949: NF House of Commons as a representative for Kingston City Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Knight, Robert (Roy) Ross This individual participated in: 1945: House of Commons as a representative for Saskatoon City 1949: NF House of Commons as a representative for Saskatoon City Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Knowles, Stanley Howard This individual participated in: 1945: House of Commons as a representative for Winnipeg North Centre 1949: NF House of Commons as a representative for Winnipeg North Centre Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 26 January 1949 4 February 1949 8 February 1949 9 February 1949 Laurent, Louis St. This individual participated in: 1945: House of Commons as a representative for Quebec East Number of times this person appears in the documents: 13 Debates and documents House of Commons debates on Newfoundland joining Confederation 25 April 1947 6 May 1947 8 December 1947 29 January 1948 11 March 1948 18 March 1948 19 June 1948 26 January 1949 27 January 1949 28 January 1949 7 February 1949 8 February 1949 9 February 1949 MacInnis, Angus This individual participated in: 1945: House of Commons as a representative for Vancouver East 1949: NF House of Commons as a representative for Vancouver East Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 19 June 1948 8 February 1949 9 February 1949 MacKinnon, James Angus This individual participated in: 1945: House of Commons as a representative for Edmonton West Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 MacNicol, John Ritchie This individual participated in: 1945: House of Commons as a representative for Davenport 1949: NF House of Commons as a representative for Davenport Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 25 April 1947 7 February 1949 8 February 1949 9 February 1949 Macdonnell, James MacKerras This individual participated in: 1945: House of Commons as a representative for Muskoka—Ontario 1949: NF House of Commons as a representative for Muskoka—Ontario Number of times this person appears in the documents: 4 Debates and documents House of Commons debates on Newfoundland joining Confederation 29 January 1948 19 June 1948 8 February 1949 9 February 1949 Mayhew, Robert Wellington This individual participated in: 1945: House of Commons as a representative for Victoria 1949: NF House of Commons as a representative for Victoria Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 28 January 1949 8 February 1949 9 February 1949 McIvor, Daniel (Dan) This individual participated in: 1945: House of Commons as a representative for Fort William 1949: NF House of Commons as a representative for Fort William Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Mitchell, Humphrey This individual participated in: 1945: House of Commons as a representative for Welland 1949: NF House of Commons as a representative for Welland Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Nicholson, Alexander (sandy) Malcolm This individual participated in: 1945: House of Commons as a representative for Mackenzie 1949: NF House of Commons as a representative for Mackenzie Number of times this person appears in the documents: 3 Debates and documents House of Commons debates on Newfoundland joining Confederation 7 February 1949 8 February 1949 9 February 1949 Pearkes, George This individual participated in: 1945: House of Commons as a representative for Nanaimo Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Stephenson, Charles Elwood This individual participated in: 1945: House of Commons as a representative for Durham Number of times this person appears in the documents: 1 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 Stewart, Alistair This individual participated in: 1945: House of Commons as a representative for Winnipeg North Number of times this person appears in the documents: 2 Debates and documents House of Commons debates on Newfoundland joining Confederation 8 February 1949 9 February 1949
9201
dbpedia
0
77
https://commons.wikimedi…_Cents_1941C.jpg
en
File:Canada Newfoundland George VI 10 Cents 1941C.jpg
https://upload.wikimedia…_Cents_1941C.jpg
https://upload.wikimedia…_Cents_1941C.jpg
[ "https://upload.wikimedia.org/wikipedia/commons/thumb/c/c2/Canada_Newfoundland_George_VI_10_Cents_1941C.jpg/800px-Canada_Newfoundland_George_VI_10_Cents_1941C.jpg?20150222040823", "https://upload.wikimedia.org/wikipedia/commons/thumb/f/f0/Permission_logo_2021.svg/75px-Permission_logo_2021.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/7/77/Wikimedia_Commons_Query_Service_Logo.svg/15px-Wikimedia_Commons_Query_Service_Logo.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/9/95/Canada_Newfoundland_George_VI_10_Cents_1941C_%28obv%29.jpg/220px-Canada_Newfoundland_George_VI_10_Cents_1941C_%28obv%29.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/e/e2/Canada_Newfoundland_George_VI_10_Cents_1941C_%28rev%29.jpg/220px-Canada_Newfoundland_George_VI_10_Cents_1941C_%28rev%29.jpg", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/62/PD-icon.svg/64px-PD-icon.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/d/d9/Flag_of_Canada_%28Pantone%29.svg/80px-Flag_of_Canada_%28Pantone%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/7/79/CC_some_rights_reserved.svg/90px-CC_some_rights_reserved.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/1/11/Cc-by_new_white.svg/24px-Cc-by_new_white.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/6/67/Money_Coin_Icon.svg/64px-Money_Coin_Icon.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/c/c2/Canada_Newfoundland_George_VI_10_Cents_1941C.jpg/120px-Canada_Newfoundland_George_VI_10_Cents_1941C.jpg?20150222040823", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://commons.wikimedia.org/static/images/footer/wikimedia-button.svg", "https://commons.wikimedia.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[]
1941-08-20T00:00:00
en
/static/apple-touch/commons.png
https://commons.wikimedi…_Cents_1941C.jpg
This work is free and may be used by anyone for any purpose. If you wish to use this content, you do not need to request permission as long as you follow any licensing requirements mentioned on this page. The Wikimedia Foundation has received an e-mail confirming that the copyright holder has approved publication under the terms mentioned on this page. This correspondence has been reviewed by a Volunteer Response Team (VRT) member and stored in our permission archive. The correspondence is available to trusted volunteers as ticket #2015012110018886.
9201
dbpedia
2
81
https://www.cbc.ca/news/canada/newfoundland-labrador/union-part-time-dominion-1.5179587
en
'People need to work,' Unifor says as Newfoundland Dominion stores restructure
https://i.cbc.ca/1.44128…0/lana-payne.jpg
https://i.cbc.ca/1.44128…0/lana-payne.jpg
[ "https://www.cbc.ca/a/images/nojsimg.gif", "https://i.cbc.ca/1.4412886.1511300491!/fileImage/httpImage/image.jpg_gen/derivatives/16x9_780/lana-payne.jpg", "https://i.cbc.ca/1.4368611.1508843970!/fileImage/httpImage/image.jpg_gen/derivatives/original_300/dominion-grocery-store-chain-loblaws.jpg 300w,https://i.cbc.ca/1.4368611.1508843970!/fileImage/httpImage/image.jpg_gen/derivatives/original_460/dominion-grocery-store-chain-loblaws.jpg 460w,https://i.cbc.ca/1.4368611.1508843970!/fileImage/httpImage/image.jpg_gen/derivatives/original_620/dominion-grocery-store-chain-loblaws.jpg 620w,https://i.cbc.ca/1.4368611.1508843970!/fileImage/httpImage/image.jpg_gen/derivatives/original_780/dominion-grocery-store-chain-loblaws.jpg 780w,https://i.cbc.ca/1.4368611.1508843970!/fileImage/httpImage/image.jpg_gen/derivatives/original_1180/dominion-grocery-store-chain-loblaws.jpg 1180w" ]
[]
[]
[ "" ]
null
[ "CBC News" ]
2019-06-18T14:18:00+00:00
The union says Loblaw is exploiting part-time employees by shouldering them with full-time hours.
en
/a/apple-touch-icon.png
CBC
https://www.cbc.ca/news/canada/newfoundland-labrador/union-part-time-dominion-1.5179587
The union representing Dominion grocery store workers says a recent decision to restructure stores is exploiting part-time employees. In a news release Monday, Unifor, which represents more than 1,200 workers at 11 stores across Newfoundland, said Loblaw Companies Ltd. is offering workers buyout packages. The goal is to eliminate 44 full-time positions within the grocery store giant, the statement says, and by doing so, "the company continues to exploit part-time workers to fill shifts." "For the most part what we're seeing is what was initially full-time employment, full-time jobs, those duties are now being spread out over part-time employees. And it's really been an ongoing kind of erosion of full-time work at Loblaw over any number of years," said Lana Payne, Unifor's Atlantic director, Tuesday afternoon. The company, however, said the decision to eliminate roles was to "simplify operations." Loblaw raises quarterly dividend, reports 1st quarter profit down "I think the public would probably be very surprised to know that upwards of 75 per cent," of the people Unifor represents at Dominion stores are classified as part-time, Payne told CBC Radio's On the Go. Payne said the company's move is to make more money, despite earning more than $800 million in profits last year. "I think there's an expectation, I certainly have one, that corporations as big and as profitable as Loblaws are doing a little bit better here." She said the union is encouraging people not to use self checkout lanes. It also plans to demand an audit of all department schedules to see if Loblaw is using part-time workers in a full-time capacity without treating them as such. "This can't go this far, people need to work, we need to have an economy with decent jobs in it so people can provide for their families," said Payne. Company offering buyouts In a statement, Loblaw Companies Ltd. said the decision was made to "simplify our operations and to serve customers best." "This has resulted in the elimination of some roles, changes to others in several departments including new opportunities for some." The company said it hopes the changes can be made through voluntary buyouts and early retirements. "We are working through those conversations with affected individuals."
9201
dbpedia
3
59
https://www.economist.com/news/2007/10/12/a-far-country
en
A far country
https://www.economist.co…llback-image.png
https://www.economist.co…llback-image.png
[]
[]
[]
[ "" ]
null
[ "The Economist" ]
2007-10-12T00:00:00
Nationalist sentiment without a state | News
en
/favicon.ico
The Economist
https://www.economist.com/news/2007/10/12/a-far-country
9201
dbpedia
2
42
https://www.cbc.ca/news/canada/newfoundland-labrador/dominion-strike-loblaw-letter-no-improved-offer-1.5710476
en
Loblaw vows no 'improved offer' as Unifor digs in heels on Dominion strike
https://i.cbc.ca/1.56988…nifor-worker.jpg
https://i.cbc.ca/1.56988…nifor-worker.jpg
[ "https://www.cbc.ca/a/images/nojsimg.gif", "https://i.cbc.ca/1.4652285.1525724111!/fileImage/httpImage/image.JPG_gen/derivatives/16x9_780/dominion.JPG", "https://i.cbc.ca/1.5698880.1598367180!/fileImage/httpImage/image.jpg_gen/derivatives/original_300/dominion-strike-unifor-worker.jpg 300w,https://i.cbc.ca/1.5698880.1598367180!/fileImage/httpImage/image.jpg_gen/derivatives/original_460/dominion-strike-unifor-worker.jpg 460w,https://i.cbc.ca/1.5698880.1598367180!/fileImage/httpImage/image.jpg_gen/derivatives/original_620/dominion-strike-unifor-worker.jpg 620w,https://i.cbc.ca/1.5698880.1598367180!/fileImage/httpImage/image.jpg_gen/derivatives/original_780/dominion-strike-unifor-worker.jpg 780w,https://i.cbc.ca/1.5698880.1598367180!/fileImage/httpImage/image.jpg_gen/derivatives/original_1180/dominion-strike-unifor-worker.jpg 1180w", "https://i.cbc.ca/1.5091833.1708123273!/cpImage/httpImage/image.jpg_gen/derivatives/original_300/loblaw-results-20180725.jpg 300w,https://i.cbc.ca/1.5091833.1708123273!/cpImage/httpImage/image.jpg_gen/derivatives/original_460/loblaw-results-20180725.jpg 460w,https://i.cbc.ca/1.5091833.1708123273!/cpImage/httpImage/image.jpg_gen/derivatives/original_620/loblaw-results-20180725.jpg 620w,https://i.cbc.ca/1.5091833.1708123273!/cpImage/httpImage/image.jpg_gen/derivatives/original_780/loblaw-results-20180725.jpg 780w,https://i.cbc.ca/1.5091833.1708123273!/cpImage/httpImage/image.jpg_gen/derivatives/original_1180/loblaw-results-20180725.jpg 1180w" ]
[]
[]
[ "" ]
null
[ "CBC News" ]
2020-09-03T13:23:00+00:00
The union representing striking Dominion workers has released a letter it was sent from Loblaw, saying there's no better deal to be had than the one already rejected.
en
/a/apple-touch-icon.png
CBC
https://www.cbc.ca/news/canada/newfoundland-labrador/dominion-strike-loblaw-letter-no-improved-offer-1.5710476
The union representing the 1,400 Dominion workers on picket lines across Newfoundland is digging in its heels, after receiving a letter from parent company Loblaw stating there's no better deal to be had than the one already rejected. In a two-page letter, dated Sept. 1, to the workers, Loblaw's Atlantic Canada vice-president Mike Doucette lays out the company's side: competition is fierce, business at Dominions across Newfoundland is in decline, and the tentative agreement reached at the end of July was still on the table. "You need to know that this strike will not result in an improved offer," Doucette says at the end of the letter. In a reply the next day, Unifor Local 597's bargaining committee was no less blunt in rejecting Loblaw's stance. While its letter acknowledged "the business is right now struggling," the union pointed to Loblaw's national profits, the CEO's multimillion-dollar compensation and their own wages, which they said were mostly under $15 an hour. "Ultimately, when workers feel they've had enough, then they're going to fight back. And that's what we're seeing here, and now Dominion's sharing in the very same pain that the workers have been feeling for many many years," Chris MacDonald, assistant to the national president of Unifor, told CBC Radio's St. John's Morning Show. "We find ourselves in a stalemate with the company." N.L. Supreme Court grants Loblaw injunction against striking Dominion workers The union has been on strike since Aug. 22, with all 11 Dominion stores in Newfoundland closed since. Difference of financial opinions In his letter, Doucette outlines the rejected Loblaw offer, which he says included "fair wage increases" for each of the three years in the agreement, as well as creating additional full-time jobs and security for the existing ones. But the letter states a $2 wage increase — the same amount temporarily provided to workers at the height of the pandemic — "sets all of us up to fail" as it would "literally put the business at risk." Elsewhere, the letter states that some Newfoundland stores have seen "double-digit declines" in business as pressure continues from chains like Coleman's and Costco. In a statement to CBC, Loblaw said, "We just want our colleagues to understand the strength of the recommended offer, which includes annual wage increases and more full time jobs." Scrapping $2 hourly bonus for grocery store workers 'a slap in the face': Loblaw baker Grocery chains scrap $2 hourly pay bump for workers implemented at start of COVID-19 During a bargaining process, MacDonald said, the union is usually given financial records to validate company's claims such as those, but that didn't happen this time, with instead Loblaw officials making a short speech. "They make these claims about profitability, but we haven't seen any proof of that," said MacDonald. At its national level, Loblaw did report a dip in profits in its second quarter of 2020 compared with the same time frame the year before, although its food retail sector saw a sales growth of 10 per cent. The company also spent about $180 million on temporary pay premiums. Loblaw reported earnings of $240 million in its first quarter of 2020, an increase of $42 million over the same period last year. A Canada-wide campaign? In its letter, Unifor says it's awaiting a phone call from Loblaw. MacDonald said the local is ready to go back to the bargaining table but there is no intention of doing so if the deal doesn't change. At a certain point, he said, the issue becomes bigger than just the picket lines in one province. "I don't think that anybody in Newfoundland is happy with what's going on here. The strings are being pulled from Toronto. This is about them not wanting to set a national wage pattern," MacDonald said. "This is about an inherent problem that Loblaws and other grocers have." While the two sides appear at a stalemate for now, MacDonald said Unifor will spend its Labour Day weekend reaching out to workers at Loblaw brands across the country. "We plan to raise this conversation nationally," he said.
9201
dbpedia
2
9
https://canadacurrency.com/canadian-banknotes/
en
Province of Canada and Newfoundland Government Currency
https://canadacurrency.c…rency_Header.jpg
[ "https://canadacurrency.com/wp-content/uploads/2022/02/CanadaCurrency_Header.jpg", "https://canadacurrency.com/wp-content/uploads/2016/06/Canada-Auction-Stacks-Banner.jpg", "https://canadacurrency.com/wp-content/uploads/2016/06/Canadian-Coin-Auctions-Stacks.jpg", "https://canadacurrency.com/wp-content/themes/saico-v1.0.3/images/cta-image.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "https://canadacurrency.com/wp-content/uploads/2013/11/Prince-Edward-Island-1872-Ten-Dollar-Bank-Note-150x67.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "https://canadacurrency.com/wp-content/uploads/2018/06/CA82-150x72.jpg", "https://canadacurrency.com/wp-content/uploads/2018/06/CA83-150x70.jpeg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "https://canadacurrency.com/wp-content/uploads/2018/06/CA84-150x74.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://antiquemoney.com/wp-content/uploads/2013/08/Rare-Philippine-Bank-Note-150x60.jpg", "http://canadacurrency.com/wp-content/uploads/2013/11/canada-logo4.png", "https://canadacurrency.com/wp-content/uploads/2013/11/canada-banner-bottom2.jpg", "https://canadacurrency.com/wp-content/uploads/2016/06/Sell-Canadian-Currency-NYC-banner.jpg", "https://canadacurrency.com/wp-content/uploads/2013/11/currency_ca_slide2.gif" ]
[]
[]
[ "province of canada currency", "newfoundland government cash note currency", "prince edward island banknotes" ]
null
[]
2013-11-21T20:58:26+00:00
We have a guide for strange and rare banknotes from Canada that fall outside of the main collecting categories. These bank notes, while slightly odd, are still very collectible and sometimes very rare. We provide free appraisals. Contact us for an offer.
en
http://canadacurrency.com/wp-content/uploads/2013/10/canada-flag-Copy.png
Canadian Currency |
https://canadacurrency.com/canadian-banknotes/
Other Types of Collectible Banknotes from Canada Most Canadian banknotes are either from The Bank of Canada (La Banque Du Canada), The Dominion of Canada, or a Canadian chartered bank. However, there are still lots of banknotes that are very rare and valuable that do not fall into one of those three categories. We are attempting to highlight some of the rarer and reasonably available banknotes from outside of the main collecting areas. We are specifically looking at Province of Canada banknotes, Prince Edward Island banknotes, and Newfoundland Government banknotes. Read the guide below and click on a banknote image to learn more about that specific issue. Please remember that we buy banknotes and provide free appraisals. Don’t hesitate to contact us for any reason. Province of Canada 1866 Banknotes These are a very unique issue. These banknotes were first designed, printed, and released for circulation when Canada was still a province. All of these notes are dated as October 1st 1866. They were actually printed and used for several years after that date. We are only showing one, two, and five dollar banknotes. However, $10, $20, $50, $100, and $500 bills were also issued. All of those higher denominations are extremely rare and not something you are likely to find today. These notes are valued based on their condition, denomination, and "Payable At" location. Montreal is the most common location. Other towns include Toronto, St. John, and Halifax. Please contact us if you need help valuing your banknote. Prince Edward Island 1872 Banknotes These are not the only banknotes to reference Prince Edward Island, but they are the most common. We are looking at $10 and $20 bills dated as 2nd January 1872. These were issued before Prince Edward Island joined the confederation in 1873. These notes are usually worth at least $2,000, or more based on their condition. Contact us for details. Government of Newfoundland 1920 Banknotes Here are some colorful and popular Canadian banknotes. These were issued because of a shortage in silver change around 1920. Silver was more valuable in other parts of the world, so people were melting coins and selling them for a profit. There were 600,000 Jany 2nd 1920 $1 bills and 300,000 January 1920 $2 bills printed. Of that total it is thought that around $12,000 in face value still survives today. That means that these aren't traditionally rare. However, high grades notes are few and far between. These are some of our favorite Canadian banknotes and we would welcome the chance to buy any examples. Newfoundland Government Cash Notes These are really interesting and historic Canadian banknotes. Newfoundland Government Cash Notes were issued from 1901 to 1914. They are kind of like a check or money order. The government used these to pay construction and maintenance crews working in Newfoundland. The notes were supposed to trade like cash. They could be redeemed at local banks. Once redeemed they were destroyed. Any denomination higher than $1 is very rare. Notes is grades above VF are also difficult to locate. These banknotes are a neat subset to currency collecting. Contact us if you would like a free appraisal. GOT SOMETHING TO SELL? We buy all of the Canadian banknotes we have listed in our guide above. Most are worth at least a few hundred dollars. However, we frequently pay thousands of dollars for rare and/or high grade examples. Please send us pictures of your paper money and we will respond back quickly with a free appraisal and our best offer. The value might surprise you in a good way.
9201
dbpedia
1
56
https://www.abebooks.com/Dominion-Canada-Newfoundland-Excursion-Alaska-Handbook/31214094817/bd
en
The Dominion of Canada with Newfoundland and an Excursion to Alaska: Handbook for Travellers by Baedecker, Karl: Very Good (1907) Third edition.
https://pictures.abebook…1214094817_2.jpg
[ "https://pictures.abebooks.com/inventory/md/md31214094817.jpg", "https://pictures.abebooks.com/inventory/md/md31214094817_2.jpg", "https://pictures.abebooks.com/inventory/md/md31214094817_3.jpg", "https://assets.prod.abebookscdn.com/cdn/shared/images/Shared/css/seller-rating/threestar.svg", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/icons/cc-visa.png", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/icons/cc-masterc.png", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/icons/cc-amex.png", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/icons/wallet_applepay.png", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/icons/wallet_googlepay.png", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/social/facebook.svg", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/social/x-twitter.svg", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/social/instagram.svg", "https://assets.prod.abebookscdn.com/cdn/shared/images/common/footer/abebooks-footer-logo.png" ]
[]
[]
[ "" ]
null
[]
1907-08-20T00:00:00
Third edition. - Karl Baedeker, Leipzig, Germany - 1907 - Condition: Very Good - 16mo (6"x4"). 331pp. Red flex covers, blindstamped with giltstamped titles. Marbled textblock edges. 13 full color maps, 5 of which are fold-outs and "12 plans". Light shelfwear: rubbed edges, warp, soiling. Pages toned. Heavily foxed endpapers. Slight warp throughout. Lower half of first fold-out loose at gutter. - The Dominion of Canada with Newfoundland and an Excursion to Alaska: Handbook for Travellers
en
https://www.abebooks.com/Dominion-Canada-Newfoundland-Excursion-Alaska-Handbook/31214094817/bd
Terms of Sale: We guarantee the condition of every book as it's described on the Abebooks web sites. If you're dissatisfied with your purchase (Incorrect Book/Not as Described/Damaged) or if the order hasn't arrived, you're eligible for a refund within 30 days of the estimated delivery date. If you've changed your mind about a book that you've ordered, please use the Ask bookseller a question link to contact us and we'll respond within 2 business days. Shipping Terms: Shipping costs are based on books weighing 2.2 LB, or 1 KG. If your book order is heavy or oversized, we may contact you to let you know extra shipping is required.
9201
dbpedia
1
57
https://www.td.com/ca/en/personal-banking/solutions/exchange/currency-converter
en
Currency Converter, Foreign Exchange Rates & Services – TD Canada Trust
[ "https://www.td.com/content/dam/tdct/images/business-banking/country-ca-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-ca-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-us-en.png", "https://www.td.com/content/dam/wealth/images/direct-investing/td-logo-en.png", "https://www.td.com/content/dam/tdct/images/personal-banking/td-logo-en.png", "https://www.td.com/content/dam/tdct/images/personal-banking/td-logo-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-ca-en.png", "https://www.td.com/content/dam/tdct/images/business-banking/country-us-en.png" ]
[]
[]
[ "" ]
null
[]
null
Get today's exchange rates, exchange foreign currency cash, transfer funds, send money abroad, and more! Use our currency converter to convert 50+ currencies.
en
/etc.clientlibs/tdsite/clientlibs/clientlib-wealth/resources/images/wealth-favicon.ico
https://www.td.com/ca/en/personal-banking/solutions/exchange/currency-converter
This information is for our Personal Banking Customers. When we refer to foreign currency, we are referring to a currency other than Canadian Dollars. A foreign currency exchange is a purchase that occurs when you purchase foreign currency from us or we purchase foreign currency from you. An exchange rate is the price at which one currency can be purchased or sold for another currency. For example, the exchange rate determines how much in Canadian Dollars it will cost to purchase U.S. Dollars. Exchange rates fluctuate throughout the day. How the foreign exchange process works: We set the exchange rate for foreign currency purchases associated with many services, such as when you: Purchase foreign currency in cash from us, or we purchase foreign currency in cash from you; Purchase a draft in a currency that is different from the currency you are using to buy the draft; Send a wire transfer in a currency that is different from the currency of the account you are sending from; or Receive a wire payment or deposit a cheque in a currency that is different from the currency of the account into which you are depositing the funds. For these services, we will quote to you our applicable exchange rate for the transaction and you may choose whether or not to complete the transaction. When funds to be deposited into your account with us are in a currency that is different from that account, such as with an incoming wire transfer, we convert the funds into the currency of your account, and then deposit them into your account. The exchange rate we use is our applicable exchange rate in effect when the deposit is posted to your account. There are other services where we do not set the exchange rate, such as when you use your debit or credit card outside of Canada to withdraw cash from an ATM or make a purchase. You will pay different exchange rates and fees for those services and you should review the agreements governing services and the use of those cards for more information. How do we set our exchange rates: For each foreign currency purchase where we set the exchange rate, the exchange rate we use is a retail exchange rate, except for purchases and sales between banks and other large financial institutions in the interbank (wholesale) market where an interbank exchange rate is used. We update our Retail exchange rates frequently throughout the day based on many factors, including: Interbank exchange rates (these are the wholesale rates for very large currency purchases and sales between banks and other large financial institutions in the interbank (wholesale) market, That are often quoted in the media); The amount of the foreign currency purchase; Whether the transaction involves foreign currency in cash; and Our costs and risks related to dealing in foreign currency. Cash and non-cash rates: Exchange rates for foreign currency transactions not involving physical foreign currency cash (bank notes), such as transfers, payments, cheques or drafts, are generally more favourable to you than rates for buying and selling physical foreign currency cash. This reflects our costs and risks of shipping, handling and holding foreign currency in cash. Exchange rate fluctuation risk – returns and reversals If you deposit funds (e.g. cheque or wire transfer) that were converted to the currency of your account before they were deposited), and then that deposit is reversed or returned, we convert the funds (in the original currency of the funds deposited) to the currency of your account, and then debit the converted amount from your account. The exchange rate we use is our applicable rate in effect when the debit is posted to your account. The amount debited may be different from the amount deposited because of exchange rate fluctuations. For example: Monday: You come to a branch to deposit a US$100 cheque into your Canadian Dollar account. Exchange rate: 0.75 Conversion: US$100 x 0.75 = C$75 deposited to your account. Wednesday: Cheque is returned unpaid (e.g. insufficient funds in the account of the person who wrote the cheque). Exchange rate: 0.80 Conversion: US$100 x 0.80 = C$80 withdrawn from your account. Similarly, if the funds you sent are returned or reversed, the amount returned to you may be different than the amount withdrawn from your account for the transfer because of exchange rate fluctuations. For example: Monday: You come to a branch to send EUR100 by wire transfer from your Canadian Dollar account. Exchange rate: 0.75 Conversion: EUR100 x 0.75 = C$75 withdrawn from your account, converted to EUR100 and sent by wire transfer.
9201
dbpedia
3
19
http://suffragio.org/2015/07/22/the-lessons-of-newfoundlands-1948-referendum/
en
The lessons of Newfoundland’s 1948 referendum
http://suffragio.org/wp-content/uploads/2015/07/newfoundland-1024x576.jpg
[ "http://suffragio.org/wp-content/uploads/2015/07/newfoundland-1024x576.jpg", "http://suffragio.org/wp-content/uploads/2014/07/newfoundland.jpg", "http://suffragio.org/wp-content/uploads/2012/02/Canada-Flag-Icon1.png", "http://suffragio.org/wp-content/uploads/2015/07/newfmap.jpg", "http://suffragio.org/wp-content/uploads/2015/07/fishermanmural-1024x576.jpg", "http://suffragio.org/wp-content/uploads/2015/07/smallwood.jpg", "http://suffragio.org/wp-content/uploads/2015/07/newfoundland1.png", "http://suffragio.org/wp-content/uploads/2015/07/newfoundland2.png", "http://suffragio.org/wp-content/uploads/2015/07/newfoundlandflag-1024x576.jpg", "http://suffragio.org/wp-content/uploads/2015/07/tricolor-1024x576.jpg", "http://suffragio.org/wp-content/uploads/2011/07/suffragio-copy1-48x18.jpg", "https://www.paypal.com/en_US/i/scr/pixel.gif", "https://pbs.twimg.com/profile_images/1655905553393090560/mdFR8wKn_normal.jpg", "http://suffragio.org/wp-content/plugins/wp-polls/images/loading.gif" ]
[]
[]
[ "" ]
null
[ "Kevin Lees" ]
2015-07-22T00:00:00
en
http://suffragio.org/2015/07/22/the-lessons-of-newfoundlands-1948-referendum/
Imagine a North America with three, not two, countries north of the Rio Grande — the United States, Canada and… Newfoundland. Newfoundland!? That’s right. The Canadian outpost in the north Atlantic. Imagine today a proud population of nearly 530,000, now basking in the proceeds of a thriving offshore oil market, growing interest in summer tourism and a historical reliance on fisheries. It’s not as crazy as it sounds — and if not for the votes of 7,000 Newfoundlanders on this day in 1948, the proudly sovereign country of Newfoundland and Labrador might exist today as a strategic Atlantic hub. With an area slightly larger than Bangladesh or Greece, and with a population similar to that of Luxembourg and larger than the populations of Iceland, Belize, Brunei or Malta, the Canadian province today has a GDP per capita of nearly $68,000, in Canadian dollars (as of 2013) — much higher than the Canadian average of nearly $54,000. On July 22, 1948, nearly 150,000 Newfoundlanders voted in the second of two fiercely contested referenda. They decided, however narrowly, in favor of confederation with Canada. On April 1 of the following year, Newfoundland and Labrador became the 10th Canadian province. The referendum brought to an end 15 years of uncertain status — that’s because in 1934, the essentially independent ‘Dominion of Newfoundland’ reverted back to colonial status after a financial crisis left the country unable to service its debt. Sound familiar? Relations today between Greece and the rest of the eurozone (most especially Germany) are as strained as ever. With a third bailout effectively ceding control of Greek fiscal policy from prime minister Alexis Tsipras to European authorities, Newfoundland’s example holds instructive lessons on sovereignty and debt. The referendum — and the failure of the pro-independence campaign — also provides a data point for aspiring nations like Scotland and Catalunya. Nearly 80 years of sovereignty Newfoundland first won self-rule in 1854, with the introduction of ‘responsible government,’ and it acquired more formal dominion status (equivalent to the dominion status Canada held) in 1907. That independence was always somewhat constrained by Newfoundland’s economy. Stretching back to the earliest claims on the territory after the first English voyage to the New World, led by John Cabot in 1497, and throughout the tussles over its control between the English and the French in the 17th and early 18th centuries, cod fishing dominated the island’s economy. Fishermen would harvest the cod from the plentiful fish banks surrounding Newfoundland’s shores and, in the days before refrigeration, dry the cod for shipment and sale to Europe. Demand for a protein like dried fish, however, ebbed and flowed with global economic trends, making independent Newfoundland highly dependent on foreign trade to meet its own obligations. In the 1890s, it was forced to turn for the first time to Canadian banks to extend credit and avoid a default. The experience left the Canadians and Newfoundlanders mutually suspicious, and in the early 20th century, Newfoundland’s premier Sir Robert Bond tried to negotiate a free-trade accord with the United States (an attempt thwarted in 1905 by US senator Henry Cabot Lodge, despite the support of the US president at the time, Theodore Roosevelt). World War I was particularly harsh on Newfoundland — nearly all of the members of the Newfoundland Regiment were killed on the first day of the Battle of the Somme. Taken together, its portion of the British empire’s war debt amounted to $35 million. Still rebuilding after the loss of so many of its young, able-bodied men in Europe, Newfoundland and its export-driven economy crumbled, predictably, with the crash of 1929. By 1933, the country was unable to service its debt, which had grown to $97 million (including its war obligations). Canadian banks, also struggling during the Great Depression, had no desire to extend financial credit, and Canada’s government wasn’t willing to provide political cover to Newfoundland. So, nearly overnight, 79 years of home rule and a tradition of national politics ended, and Newfoundland once again became a colony under direct British rule. From dominion status to debt colony As the Great Depression waned and World War II gradually became the more pressing matter, Newfoundland emerged as a convenient colonial holding for the British. The aviation base at Gander (established only in 1935) became a vital stopping point in the mid-Atlantic efforts of British and American air forces during the war. As you might expect, the British-dominated commission that administered Newfoundland never quite found the time to address its status during the war effort. Though the colony’s geostrategic importance crested throughout World War II, Newfoundlanders also rediscovered their love of Americans. With so many US military personnel in Newfoundland, locals developed strong ties — including a fair share of marriages. Newfoundlanders felt for the United States none of the disdain it held for Canada, stretching back to the financial crisis of the 1890s, and none of the scorn it shared for its British debtor overlords. By the end of the war, the friendly sentiment towards the United States was so strong that Newfoundlanders talked freely about economic partnership — or even, eventually, becoming a full American state. Canada, suddenly very concerned that the Americans might scoop up much of the North Atlantic coastline, began to force the Newfoundland issue on Great Britain. The British, for their part, were already looking to liquidate their colonial holdings and, with the war now over, the Newfoundland question could no longer be further delayed. Though there’s no clear evidence that the ultimate voting was fraudulent, authorities in Ottawa and London did their best to nudge Newfoundland toward Canadian union. Canada made clear in negotiations that it would be willing to assume much of Newfoundland’s debt; the British government made it equally clear that Newfoundland would get little in return for reverting to ‘responsible government.’ Even the nature of the two referenda also boosted confederation — when no option won a clear majority in the first vote, elites decided to hold a second vote between the top two options. Two pivotal 1948 votes to determine Newfoundland’s future The campaign was a vigorous one — though it was somewhat more complicated than a direct two-way fight between independence and confederation. Confederation’s champion was Joey Smallwood — a Liberal radio show host who embraced Canada and who nearly single-handedly pushed the cause through the Confederation Association. The cause of merging into Canada attracted support mainly from the Protestants of rural Newfoundland and Labrador; less so from the urban business class of St. John’s. After successfully pushing confederation, Smallwood (pictured above) would become the province’s first and most long-lasting premier, serving until 1972 and shaping Newfoundland’s transition as a part of federal Canada. Peter Cashin, a one-time Newfoundlander finance minister, was a member of the 1947 commission to London that so disappointed Newfoundland’s leaders when the UK government refused to commit to financial assistance. Disillusioned by British intentions, and rightly suspecting that the British and Canadian government were colluding to favor confederation, Cashin led the Responsible Government League throughout the referendum campaign. In a famous 1947 speech to the national convention on Newfoundland’s future, he condemned what he called: a conspiracy to sell… this country to the Dominion of Canada. Watch in particular the attractive bait which will be held out to lure our country into the Canadian mousetrap. Listen to their flowery sales talk which will be offered to you; telling Newfoundlanders they’re a lost people…. At minimum, Cashin believed that a return to responsible government would give Newfoundland a stronger hand in any potential talks on confederation, including the terms on which Newfoundland might join Canada — with respect to debt, provincial assistance and Newfoundland’s rights vis-à-vis the national government with respect to fishing and resources. The most beguiling option came with the Economic Union Party, the brainchild of businessman Chelsey Crosbie. Though you might not be able to tell it from the name, the ‘economic union’ meant union with the United States — not with Canada. Crosbie’s group, which became even more popular than the Responsible Government League, hoped that independence would allow closer ties with the United States. US statehood was never presented on the ballot, even though there’s a plausible case that it might have won in light of the Newfoundlandish good will to the Americans during World War II. Though US president Harry Truman never seriously considered annexation, it’s conceivable that after a decade of closer economic partnership, Newfoundland could have become the 51st American state in 1959 alongside Alaska and Hawaii. As established by the national convention (and heavily influenced by the British commission still governing Newfoundland), the first referendum on June 3 presented three choices — (i) confederation with Canada, (ii) retaining commission government (i.e., as a British colony) or (iii) a return to ‘responsible government’ (i.e., independence). None of the options won more than 50% of the vote, though independence emerged with the largest share among 155,797, a turnout of around 88%. With no clear mandate for confederation or for independence, Newfoundland’s government scheduled a runoff between the top two options. Smallwood, the best Newfoundland politician of his generation, rallied the rural Protestant electorate, effectively outwitting the pro-independence business class in St. John’s and throughout the more Catholic Avalon peninsula. Despite the joint efforts of the Responsible Government League and the Economic Union Party, Smallwood simply rallied more voters in an election that registered wide swings in opinion. Nearly 78% of Labrador’s voters, for example, supported confederation, while St. John’s voted at around 68% in favor of responsible government. By a margin of just under 7,000 votes, Newfoundlanders turned to confederation. Perhaps the most important lesson from the Newfoundland example is that independence is a much easier cause when an overwhelming proportion of the population favors it. As in the case of Newfoundland, when a region is narrowly divided, it’s hard to achieve a convincing pro-independence majority (Quebec in 1980 and 1995, for example, and Scotland in 2014). But once the cause reached a certain tipping point, the path to independence seems clear. In Norway (1905), Iceland (1944) and South Sudan (2011), the independence option won over 99% of the vote. Confederation with Canada and Newfoundland’s economic decline With the 10th province’s addition, Ottawa secured a Canadian writ from Pacific coast to Atlantic coast and, more importantly, won national control over Labrador’s iron ore and Newfoundland’s Grand Banks. In exchange, Canada assumed Newfoundland’s debt obligations and committed to additional family relief in the form of ‘baby bonuses’ to the province. But Newfoundland stagnated throughout the second half of the 20th century, with its natural resources diverted to national use. Under the control of the federal Department of Fisheries and Oceans, Newfoundland’s fishing stocks suffered from overfishing as Ottawa awarded concessions to foreign fishing interests. In 1992, the government reversed course by imposing a moratorium on cod fishing, which essentially forced the collapse of Newfoundland’s fishing industry. That, however, may have been too late, and cod stocks still haven’t recovered. The moratorium instantly eliminated nearly 40,000 jobs for Newfoundlanders, causing an unemployment and economic crisis that marked the province’s post-confederation nadir. When you go to Newfoundland today, the most striking thing is perhaps the lack of rail infrastructure (or even road infrastructure) that connects so much of mainland Canada. It’s almost certain that the young, newly independent country would have struggled, given London’s indications that it would receive no debt relief upon a return to ‘responsible government.’ But taking advantage of Gander’s notoriety, Newfoundland was well on its way to becoming a transit hub for North America, rather than the Atlantic backwater it became as a Canadian province. Between 2003 and 2010, under the premiership of Danny Williams, a member of the province’s center-right Progressive Conservatives, Newfoundland seemed to reclaim some of its national swagger. Williams waged a fervent fight against Canadian prime minister Paul Martin to allow the province to keep more of the revenue developed from its growing offshore oil production — a move that made Williams the most popular premier since Smallwood. At one point in the showdown with the federal government, Williams ordered the Canadian flag removed from the province’s official buildings. Williams was so popular that, for the past five years, his legacy has floated a series of underwhelming Tory premiers. The current incumbent, Paul Davis, will make his case in the province’s next election on November 30, where the party trails both the center-left Liberals and the progressive New Democrats. The showdown with Ottawa coincided with the sense that Newfoundland’s newly exploited oil wealth might have supported the economy of an independent nation. It’s not uncommon to see, throughout St. John’s, the unique tricolor — a pink, white and green standard that has recently become a symbol of Newfoundlandish nationalism, though it was historically a flag representing the island’s Irish Catholic heritage. On the 67th anniversary of the pivotal vote that made Newfoundland a Canadian province, however, its cautionary tale still holds lessons about debt, sovereignty and international relations.
9201
dbpedia
2
43
https://www.wikidata.org/wiki/Q38610
en
Dominion of Newfoundland
https://upload.wikimedia…d_Ensign.svg.png
https://upload.wikimedia…d_Ensign.svg.png
[ "https://upload.wikimedia.org/wikipedia/commons/thumb/6/67/Dominionofnewfoundlandlocation.PNG/220px-Dominionofnewfoundlandlocation.PNG", "https://upload.wikimedia.org/wikipedia/commons/thumb/d/d2/Dominion_of_Newfoundland_Red_Ensign.svg/220px-Dominion_of_Newfoundland_Red_Ensign.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/5/53/Coat_of_Arms_of_Newfoundland_and_Labrador.svg/220px-Coat_of_Arms_of_Newfoundland_and_Labrador.svg.png", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://www.wikidata.org/static/images/footer/wikimedia-button.svg", "https://www.wikidata.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[]
null
UK possession in North America between 1907 and 1949
en
/static/apple-touch/wikidata.png
https://www.wikidata.org/wiki/Q38610
UK possession in North America between 1907 and 1949 Newfoundland edit
9201
dbpedia
0
76
https://www.pinterest.com/pin/dominion-of-canada-5-dollars-banknote-1924-queen-mary--853924779320369420/
en
https://s.pinimg.com/web…x48-7470a30d.png
https://s.pinimg.com/web…x48-7470a30d.png
[]
[]
[]
[ "" ]
null
[]
2018-03-27T11:37:52+00:00
Dominion of Canada Five Dollar 1924 Queen Mary Dominion of Canada 5 Dollar 1924 Queen Mary Very few of the 1924 $5 notes ever hit ...
en
https://s.pinimg.com/web…144-3da7a67b.png
Pinterest
https://se.pinterest.com/pin/dominion-of-canada-5-dollars-banknote-1924-queen-mary--853924779320369420/
9201
dbpedia
2
79
https://www.amazon.com/1904-1908-Newfoundland-Eventually-Incorporated-Circulated/dp/B0CF7N8HSH
en
Amazon.com
[ "https://images-na.ssl-images-amazon.com/captcha/kwizfixk/Captcha_hhbjrgphza.jpg", "https://fls-na.amazon.com/1/oc-csi/1/OP/requestId=AEK5M2G422PXB3Z1MZNQ&js=0" ]
[]
[]
[ "" ]
null
[]
null
en
null
Enter the characters you see below Sorry, we just need to make sure you're not a robot. For best results, please make sure your browser is accepting cookies.
9201
dbpedia
0
17
https://globalfinancialdata.com/canada
en
Global Financial Data
https://globalfinanciald…avicon-32x32.png
https://globalfinanciald…avicon-32x32.png
[ "https://globalfinancialdata.com/images/global/global-financial-data-logo-white.png 1x", "https://globalfinancialdata.com/images/currency/Canada.JPG", "https://globalfinancialdata.com/images/blog/GFD_Sector_and_Industry_Classification_System_Revised.jpg", "https://globalfinancialdata.com/images/address_icon.png", "https://globalfinancialdata.com/images/phone_icon_bl.png" ]
[]
[]
[ "" ]
null
[ "Odin Mayland" ]
0001-11-29T16:07:02-07:52
We are a Global Data provider: For over 25 years Global Financial Data has been providing alternative historical economic and financial data.
en
/templates/shaper_helixultimate/images/favicon.ico
https://globalfinancialdata.com/canada
Both the French and British set up colonies in Canada, but in by 1763, the British had gained control over all of New France. Upper and Lower Canada (Ontario and Quebec) were united as the Province of Canada on February 5, 1841, and the Dominion of Canada was established on July 1, 1867. The French Colonial Franc (XFCL) and British Pound Sterling (GBP) were used in Canada during colonial times. The French Colonial Livre traded at a 20% premium from July 18, 1654 until October 7, 1661, at a 33.3% premium until March 2, 1662, and a 50% premium thereafter. The New France government often issued playing cards as money. The first French coins were minted in Canada in 1670 and continued to be issued until 1760. Nevertheless, French, English, Dutch, Spanish and US coins circulated through the nineteenth century. Private token, minted in Britain were used in Canada until 1858. Nova Scotia (1823), New Brunswick (1843), Prince Edward Island (1871) and Newfoundland (1840) issued coins and tokens of their own. The first coins issued for Canada were minted in 1858, although technically this was a provincial issue for Canada (Ontario and Quebec). The first coins issued for the Dominion of Canada were struck in 1870 and were similar to US coins. Canada adopted the Dollar as its currency on January 1, 1858 setting the Canadian Dollar, divisible into 100 Cents, and equal to the United States Dollar. Canada allowed private banks it issue banknotes until 1935 when the Bank of Canada gained a monopoly over the right to issue banknotes. Until 1912, the Dominion of Canada issued all banknotes under $5 and private banks issued all banknotes of $5 or more, leading to the issue of $4 notes. Many of the banknotes issued by chartered banks prior to 1935 are still redeemable. Canada left the Gold Standard on October 19, 1931. See separate histories for Newfoundland and St. Pierre et Miquelon.
9201
dbpedia
0
6
https://britishcurrency.co.uk/newfoundland/
en
Newfoundland – British Currency
https://britishcurrency.…n1980R-32x32.jpg
https://britishcurrency.…n1980R-32x32.jpg
[ "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFLCent1936R-1024x1019.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFLCent1941R-1021x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL5Cents1929R-1022x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL10Cents1942R-1024x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL20Cents1900R-1019x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL20Cents1912R-1024x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL25Cents1917R-1024x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL50Cents1899largeR-1019x1024.jpg", "https://britishcurrency.co.uk/wp-content/uploads/2020/03/NFL50Cents1909R-1024x1024.jpg" ]
[]
[]
[ "" ]
null
[]
null
en
https://britishcurrency.…n1980R-32x32.jpg
https://britishcurrency.co.uk/newfoundland/
The dollar was the currency of the colony and, later, Dominion of Newfoundland from 1865 until 1949, when Newfoundland became a province of Canada. It was subdivided into 100 cents. In 1865, coins were introduced in denominations of 1, 5, 10 and 20 cents, and 2 dollars. The 1 cent was struck in bronze, the 5, 10 and 20 cents in silver and the 2 dollars (also denominated as “Two Hundred Cents” and “One Hundred Pence”) in gold. Silver 50 cents were introduced in 1870, with the 20 cents replaced by a 25-cent coin in 1917. A smaller 1-cent coin was introduced in 1938.
9201
dbpedia
2
63
https://www.canada.ca/en/parks-canada/news/2021/06/newfoundland-national-war-memorial-st-johns-newfoundland-and-labrador.html
en
Newfoundland National War Memorial, St. John’s, Newfoundland and Labrador
https://www.canada.ca/etc/designs/canada/wet-boew/assets/favicon.ico
https://www.canada.ca/etc/designs/canada/wet-boew/assets/favicon.ico
[ "https://www.canada.ca/etc/designs/canada/wet-boew/assets/sig-blk-en.svg", "https://www.canada.ca/etc/designs/canada/wet-boew/assets/wmms-blk.svg" ]
[]
[]
[ "HI History and Archaeology", "Parks Canada", "Newfoundland and Labrador", "Culture", "history and sport", "general public", "backgrounders", "Hon. Seamus O’Regan" ]
null
[ "Parks Canada" ]
2021-06-28T10:30:00
Unveiled in 1924 to commemorate the Dominion of Newfoundland’s contributions to the First World War, the Newfoundland National War Memorial is an imposing monument and an early example of modern war memorials featuring both allegorical and realistic bronze sculptures.
en
/etc/designs/canada/wet-boew/assets/favicon.ico
https://www.canada.ca/en/parks-canada/news/2021/06/newfoundland-national-war-memorial-st-johns-newfoundland-and-labrador.html
Unveiled in 1924 to commemorate the Dominion of Newfoundland’s contributions to the First World War, the Newfoundland National War Memorial is an imposing monument and an early example of modern war memorials featuring both allegorical and realistic bronze sculptures. Designed by British artists Gilbert Bayes and Ferdinand Victor Blundstone, its design elevates an allegorical female sculpture, often referred to as Victory, Liberty, or the Spirit of Newfoundland, over figures representing the Newfoundland Royal Naval Reserve, Royal Newfoundland Regiment, Forestry Corps, and Merchant Marine. Located next to where Newfoundland and Labrador soldiers departed and returned from the First World War, it is a physical and visual landmark in downtown St. John’s. The five bronze sculptures sit on a large granite base, with the largest standing atop the central pedestal, holding a flaming torch in her left hand high above her head. The torch, which symbolizes freedom, is the memorial’s highest point, prioritizing freedom as a central motivation for Newfoundland’s wartime contributions. In her right hand, she holds a sword which represents both Newfoundland’s willingness to serve during the First World War and loyalty to the British Empire. The sword is below her waist, but not completely lowered as it is poised for battle, which is meant to depict that while the war is over, Newfoundland was, and is, ready and willing to fight for its freedom and liberty. On the front of the monument, below the figures, are five plaques commemorating Newfoundland’s contributions in different conflicts. In the centre, the original plaque from 1924 honours those who served during the First World War. Plaques commemorating the service of Newfoundlanders and Labradorians in the Second World War, Korean War, Afghanistan, and War of 1812 have been added. The monument was made possible in part by a community fundraising effort where the sale of one dollar shares raised $20,000. This campaign connected the community to not only the memorial, but also to Newfoundland and Labrador’s fallen soldiers. The Great War Veterans Association and a committee led by military chaplain Thomas Nangle organized the July 1, 1924, unveiling ceremony, which included a speech from Field Marshal Douglas Haig and attracted 20,000 people. The unveiling date was selected because July 1 is Memorial Day in Newfoundland and Labrador, commemorating the Battle of Beaumont Hamel, the deadliest day for the Royal Newfoundland Regiment during the First World War. The monument sits between Water and Duckworth streets. While the city’s natural topography slopes towards St. John’s Harbour, the grade at the site was altered during construction, which gives the memorial a grand appearance when seen from the water. The torch atop the monument was originally intended to be a leading light for ships entering St. John’s Harbour through the Narrows, although it was never used as such. The Newfoundland National War Memorial is the site of annual ceremonies that take place Remembrance Day and Memorial Day. - 30 -
9201
dbpedia
1
61
https://www.facebook.com/UniforCanada/videos/dominion-workers-in-nl-defend-good-jobs-and-fair-wages-as-negotiations-are-set-t/335547420625515/
en
Dominion workers in NL defend good jobs and fair wages as negotiations are set to begin with parent company Loblaw.
https://scontent.xx.fbcd…Sgsw&oe=66C9AD55
https://scontent.xx.fbcd…Sgsw&oe=66C9AD55
[]
[]
[]
[ "" ]
null
[]
null
Dominion workers in NL defend good jobs and fair wages as negotiations are set to begin with parent company Loblaw.
de
https://static.xx.fbcdn.net/rsrc.php/yT/r/aGT3gskzWBf.ico
https://www.facebook.com/UniforCanada/videos/dominion-workers-in-nl-defend-good-jobs-and-fair-wages-as-negotiations-are-set-t/335547420625515/
1850
dbpedia
2
7
https://gupea.ub.gu.se/handle/2077/31995
en
Hereditary diffuse leukoencephalopathy with spheroids: Insights into an adult onset neurodegenerative disease
[ "https://gupea.ub.gu.se/themes/Mirage2/images/DSpace-logo-line.svg", "https://gupea.ub.gu.se/themes/Mirage2/images/atmire-logo-small.svg", "https://gupea.ub.gu.se/themes/Mirage2/images/atmire-logo-small.svg" ]
[]
[]
[ "" ]
null
[]
null
en
/themes/Mirage2/images/favicon.ico
null
Abstract During the last three decades, the areas of inherited white matter (WM) disorders have expanded. Advances in magnetic resonance imaging (MRI) and genetics have led to increased detection of adult-onset WM disorders. Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an adult-onset, invariably lethal, brain WM disorder with an autosomal dominant inheritance pattern. The clinical symptoms are characterized by a constellation of features that progress to a devastating disease with multiple neurological impairments. The neuropathological hallmarks of HDLS are demyelination and the presence of axonal spheroids. The overall aim of this study was to gather enough clinical cases, radiological images, cerebrospinal fluid (CSF) biomarkers and molecular genetic data to place HDLS in a nosographic context and define its relationship with other neurodegenerative disorders. We updated the original Swedish HDLS family and created a pedigree consisting of 166 individuals. Fifteen of those cases were affected with HDLS, including two new cases. The clinical course was different in the two recent cases, with a sub-acute and a more chronic variant, respectively. Familial clustering of HDLS is not always obvious and in the Mayo Clinic HDLS collection we found that all of our cases had been misdiagnosed with other more common neurological disorders. Using exome sequencing, we identified the colony stimulating factor 1 receptor (CSF1R) mutation in 14 Mayo Clinic HDLS families. MRIs of 15 of these CSF1R mutation carriers demonstrated asymmetric WM lesions (WML) with frontoparietal predominance. With diffusion weighted-, and diffusion tensor imaging (DTI/DWI) we defined three different stages of HDLS pathology, and detected a peripheral rim of restricted diffusion that had a centrifugal migration from the anterior ventricular horns. This might be pathognomonic for the original Swedish type of HDLS. In conclusion, HDLS is a distinct disease entity and the combination of clinical features such as frontal lobe syndromes, pyramidal-, extrapyramidal-, parietal- and visual signs, as well as WML in a characteristic frontoparietal distribution gives diagnostic clues. To clarify the distinction between the unknown genetics of the original Swedish family and the CSF1R mutation carriers, we propose to use molecular classification of HDLS type 1 and type 2, respectively. Results from our studies indicate that HDLS is probably primarily a neuroaxonal degeneration. Thus, elucidating the molecular mechanism of HDLS may provide novel insights into neurodegeneration.
1850
dbpedia
3
16
https://www.heartuk.org.uk/genetic-conditions/low-hdl-cholesterol-
en
Low HDL cholesterol
[ "https://www.heartuk.org.uk/genetic-conditions/templates/default/images/heart-uk-logo-white.svg", "https://www.heartuk.org.uk/genetic-conditions/templates/default/images/heart-uk-logo-colour.svg", "https://www.heartuk.org.uk/genetic-conditions/images/medic_cropped_682_400.jpg", "https://www.heartuk.org.uk/genetic-conditions/templates/default/images/fundraising-regulator-white.png, templates/default/images/fundraising-regulator-white-2x.png 2x" ]
[]
[]
[ "Low HDL cholesterol", "how to raise HDL cholesterol", "what causes low HDL cholesterol?" ]
null
[]
null
HDL cholesterol is a type of cholesterol that protects your heart health, and it can sometimes fall too low. Read about the causes of low HDL and how you can raise your levels.
en
https://www.heartuk.org.uk/favicon.ico
https://www.heartuk.org.uk/genetic-conditions/low-hdl-cholesterol-
HDL cholesterol is a type of cholesterol that protects your heart health, and it can sometimes fall too low. Why is HDL cholesterol important? What causes low HDL cholesterol? Lower levels of HDL cholesterol can have an underlying cause such as a health problem or certain medications. If you have low HDL cholesterol, your doctor can try to find out the cause so that they can treat it and bring your HDL up to a healthy level. Below are some of the possible causes. Smoking Smoking can lower your HDL levels because a chemical in cigarette smoke called acrolein appears to change the way HDL works in the body. It does this by changing the structure of a protein called Apolipoprotein A1, which forms part of HDL cholesterol. This might speed up the process of atherosclerosis (where fat clogs up the arteries) because HDL is less able to remove cholesterol from the artery walls. If you stop smoking, your HDL levels can rise by up to 10% as long as you don’t gain weight, which can sometimes happen when people stop smoking. Insulin resistance If you have too much fat stored in your body, particularly around your waistline, the hormone insulin is less able to control your blood sugar. This is known as insulin resistance. Insulin resistance can lead to type 2 diabetes and it’s one of the problems that makes up the metabolic syndrome, which raises the risk of heart attacks and strokes. Insulin resistance also leads to characteristic changes in the pattern of fats often referred to as ‘dyslipidaemia’. Typically, this means: high triglycerides low HDL cholesterol normal or slightly raised LDL cholesterol. The LDL cholesterol also tend to be smaller and more harmful to the arteries. Losing weight can help raise your HDL cholesterol. Genetic conditions Rarely, very low HDL cholesterol can be caused by your genes. Tangier disease. This is a very rare condition which causes no or very low levels of HDL cholesterol. LDL cholesterol levels are also usually low. A fault in a gene affects the transport of cholesterol from your cells to your HDL lipoproteins. ApoA1 deficiency. ApoA1 deficiency is a rare disorder which causes no or very low levels of a protein called Apolipoprotein A1 (Apo A1) which is an important part of HDL. Familial combined hyperlipidaemia (FCH). FCH is a fairly common condition believed to affect around 1 in every 100 people in the UK. It is similar to diabetes and insulin resistance in that it usually causes high triglycerides and low HDL cholesterol, and much higher LDL cholesterol. This pattern of blood fats is also influenced by diet and lifestyle. Medicines Certain medications can sometimes lower HDL levels, including: beta blockers thiazide diuretics androgens progestogens anabolic steroids. If you are taking any of these medications, don’t stop taking them without speaking to your health professional. It’s likely that any possible risks caused by low HDL cholesterol will be outweighed by the benefits of the medications. Raising your HDL cholesterol levels Identifying the causes of low HDL and acting on them where possible should help to raise or maintain your HDL cholesterol levels. There are also other things you can do. Eat a healthy diet We have lots of information about eating a healthy diet. In particular, try to eat only small amounts of fats. Be more active Regular aerobic exercise which raises your heart rate and gets you out of breath can raise your HDL cholesterol by about 5% within two months, improve your LDL levels and lower your triglycerides. How long you exercise for is more important than the intensity you exercise at, according to recent research, although any length of time or intensity will have benefits. Be a healthy weight Losing weight and inches around your waistline if you are overweight or carry your weight around your middle can help to raise your HDL cholesterol. Recent research shows that for every 1kg of weight loss, HDL rises by 0.01mmol/L. Even modest weight loss of 5-10% of your body weight appears to improve levels of blood fats. Further research is needed to evaluate HDL function and evaluate the effects of interventions which aim to improve HDL levels.
1850
dbpedia
1
19
https://pandsclinic.com/faq-is-high-cholesterol-genetic/
en
FAQ: Is High Cholesterol Genetic?
https://pandsclinic.com/…erol-genetic.jpg
https://pandsclinic.com/…erol-genetic.jpg
[ "https://pandsclinic.com/wp-content/uploads/2019/12/BlueGray325w.png", "https://pandsclinic.com/wp-content/uploads/2024/04/Is-High-cholesterol-genetic.jpg", "https://pandsclinic.com/wp-content/uploads/2023/03/over-the-counter-UTI-medicine-66x66.jpg", "https://pandsclinic.com/wp-content/uploads/2024/08/Can-asthma-go-away-66x66.jpg", "https://pandsclinic.com/wp-content/uploads/2024/06/Can-allergies-cause-sort-throat-66x66.jpg", "https://pandsclinic.com/wp-content/uploads/2024/08/Can-asthma-go-away-66x66.jpg", "https://pandsclinic.com/wp-content/uploads/2024/07/WorthyWelcome2-66x35.jpg", "https://pandsclinic.com/wp-content/uploads/2024/06/Can-allergies-cause-sort-throat-66x66.jpg", "https://pandsclinic.com/wp-content/uploads/2019/12/BlueGray325w-300x79.png" ]
[]
[]
[ "" ]
null
[ "Support3" ]
2024-04-10T14:41:39+00:00
High cholesterol is a common health problem that affects millions. A common question is, “Is high cholesterol genetic?”
en
https://pandsclinic.com/…on-Blue-Gray.png
Physicians & Surgeons - OB/GYN, Pediatricians, Internal Medicine
https://pandsclinic.com/faq-is-high-cholesterol-genetic/
High cholesterol is a common but potentially serious health problem that affects millions of people across the country. If you have been diagnosed with high cholesterol, you may be wondering what caused the condition to develop. The truth is that several factors can contribute to high cholesterol levels, which can vary from person to person. A common question is, “Is high cholesterol genetic?” The answer is yes; high cholesterol can be genetic, but it can also be due to diet and lifestyle factors. The topic of cholesterol can be confusing, so here’s what you need to know about high cholesterol. Types of Cholesterol in the Blood When your doctor orders blood tests to evaluate your overall health, it will usually include a lipid (fat) panel. The components of the lipid panel may list numbers for the following components: Total Cholesterol: Your total cholesterol level is the sum of all blood cholesterol types. This number includes both low-density lipoprotein (LDL) and high-density lipoprotein (HDL). A normal total cholesterol level is less than 200 mg/dl. LDL Cholesterol: Low-density lipoprotein (LDL) cholesterol is often called “bad” cholesterol because it contributes to plaque buildup within your arteries. When LDL cholesterol levels are high, it can lead to a condition called atherosclerosis. This is where plaque accumulates inside arteries, narrowing the pathways and increasing the risk of heart disease. Typically, LDL Levels below 100 mg/dl are recommended for optimal heart health. HDL Cholesterol: High-density lipoprotein (HDL) cholesterol is often called “good” cholesterol because it helps your body remove LDL cholesterol from the bloodstream so it can be processed and excreted by the liver. Higher levels of HDL cholesterol can help lower your risk of heart disease. For men, the recommended HDL level is above 40 mg/dl, and for women, the recommended HDL level is about 50 mg/dl. Triglycerides: Triglycerides are fats that come from two places: the foods you eat and your liver. Fat in your food is absorbed into the bloodstream and carried various tissues for use or storage. The liver can also make triglycerides out of excess glucose (sugar) and release them into the bloodstream. High levels of triglycerides can increase your risk of heart disease and pancreatitis. It is recommended that your triglyceride levels be below 150 mg/dl for the best heart health. Genetics and Cholesterol Genetic high cholesterol, also known as familial hypercholesterolemia, is a less common form of high cholesterol that can mainly be attributed to your genetics and family history. Most people have high cholesterol due to a diet high in saturated fats or lack of physical activity. People with genetic hypercholesterolemia may have high cholesterol even if they eat a healthy diet and exercise regularly. What if Your Cholesterol Is High? If your cholesterol levels come back abnormal, here are some tips to help you better manage your diet and reduce cholesterol levels in your blood. Increase your daily intake of soluble fibers, which are found in foods like oatmeal, bran, and whole grain cereals. Reduce your dietary intake of red meats and full-fat dairy products. Avoid trans fats entirely. Tropical oils such as palm and coconut oil are high in saturated fat and should be avoided if you have high cholesterol. Eat a variety of fish at least twice weekly. Eating fish can increase your HDL (good cholesterol). Using Omega-3 fatty acid supplements made from fish sources can be helpful if you don’t like to eat fish. Get 30 minutes of moderate activity five days per week. Quit smoking and reduce alcohol consumption. If lifestyle changes do not reduce your blood cholesterol levels, your doctor may recommend medications to help lower your cholesterol. Cholesterol-lowering medications, like statins, may be necessary for people with genetic high cholesterol. Why Managing High Cholesterol Matters Over time, high cholesterol can lead to a higher risk of stroke, blood clots (which can be fatal), or heart attack. Managing high cholesterol, whether it is genetic or not, is critical in helping ensure you live a longer, healthier life.
1850
dbpedia
0
5
https://medlineplus.gov/genetics/condition/adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/
en
onset leukoencephalopathy with axonal spheroids and pigmented glia: MedlinePlus Genetics
https://medlineplus.gov/…dition_Share.jpg
https://medlineplus.gov/…dition_Share.jpg
[ "https://medlineplus.gov/uswds/img/us_flag_small.png", "https://medlineplus.gov/uswds/img/icon-dot-gov.svg", "https://medlineplus.gov/uswds/img/icon-https.svg", "https://medlineplus.gov/images/nihlogo.png", "https://medlineplus.gov/images/m_logo_25.png", "https://medlineplus.gov/css/img/icon_camera_small.png", "https://medlineplus.gov/css/img/icon_camera_small.png", "https://medlineplus.gov/css/img/icon_camera_small.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/GeneticCounseling.jpg", "https://medlineplus.gov/images/feed.png", "https://medlineplus.gov/images/i_share_twitter.png", "https://medlineplus.gov/images/i_share_fb.png", "https://medlineplus.gov/images/Instagram_Glyph_Gradient_RGB.png", "https://medlineplus.gov/images/i_social_media_toolkit.png", "https://medlineplus.gov/images/return-top.png" ]
[]
[]
[ "" ]
null
[]
null
Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is a neurological condition characterized by changes to certain areas of the brain. Explore symptoms, inheritance, genetics of this condition.
en
https://medlineplus.gov/images/favicon.ico
https://medlineplus.gov/genetics/condition/adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/
Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is a neurological condition characterized by changes to certain areas of the brain. A hallmark of ALSP is leukoencephalopathy, which is the alteration of a type of brain tissue called white matter. White matter consists of nerve fibers (axons) covered by a substance called myelin that insulates and protects them. The axons extend from nerve cells (neurons) and transmit nerve impulses throughout the body. Areas of damage to this brain tissue (white matter lesions) can be seen with magnetic resonance imaging (MRI). Another feature of ALSP is swellings called spheroids in the axons of the brain, which are a sign of axon damage. Also common in ALSP are abnormally pigmented glial cells. Glial cells are specialized brain cells that protect and maintain neurons. Damage to myelin and neurons is thought to contribute to many of the neurological signs and symptoms in people with ALSP. Symptoms of ALSP usually begin in a person's forties and worsen over time. Personality changes, including depression and a loss of social inhibitions, are among the earliest symptoms of ALSP. Affected individuals may develop memory loss and loss of executive function, which is the ability to plan and implement actions and develop problem-solving strategies. Loss of this function impairs skills such as impulse control, self-monitoring, and focusing attention appropriately. Some people with ALSP have mild seizures, usually only when the condition begins. As ALSP progresses, it causes a severe decline in thinking and reasoning abilities (dementia). Over time, motor skills are affected, and people with ALSP may have difficulty walking. Many develop a pattern of movement abnormalities known as parkinsonism, which includes unusually slow movement (bradykinesia), involuntary trembling (tremor), and muscle stiffness (rigidity). The pattern of cognitive and motor problems are variable, even among individuals in the same family, although almost all affected individuals ultimately become unable to walk, speak, and care for themselves. ALSP was previously thought to be two separate conditions, hereditary diffuse leukoencephalopathy with spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD), both of which cause very similar white matter damage and cognitive and movement problems. POLD was thought to be distinguished by the presence of pigmented glial cells and an absence of spheroids; however, people with HDLS can have pigmented cells, too, and people with POLD can have spheroids. HDLS and POLD are now considered to be part of the same disease spectrum, which researchers have recommended calling ALSP.
1850
dbpedia
3
82
https://www.nguyenmed.com/blog/here-are-the-key-differences-between-hdl-and-ldl-cholesterol
en
Here are the Key Differences Between HDL and LDL Cholesterol: Nguyen Medical Group: Internal Medicine
https://sa1s3optim.patie…otos/2234709.png
https://sa1s3optim.patie…otos/2234709.png
[ "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2234645.png", "https://assets.pinterest.com/images/pidgets/pinit_fg_en_rect_gray_20.png", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2718631.jpeg", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2746547.jpg", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2742468.jpeg", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2736183.jpeg", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2731071.jpg", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2723599.jpg", "https://sa1s3optim.patientpop.com/assets/images/provider/photos/2711474.jpg" ]
[]
[]
[ "" ]
null
[]
null
Cholesterol testing helps you keep track of your cholesterol level so you can take steps to manage it. But to really understand your test results, you need to k
en
https://sa1s3optim.patie…/docs/194560.png
https://www.nguyenmed.com/blog/here-are-the-key-differences-between-hdl-and-ldl-cholesterol
About 86 million American adults have high cholesterol, placing them at risk of serious and life-threatening complications like heart disease, heart attack, stroke, and dementia. Even more alarming — only about half of those women and men are currently taking medicine that could help them manage cholesterol and reduce the risk of those complications. At Nguyen Medical Group, Thomas Nguyen, MD, MS, and Susan Nguyen-Mui, APRN, help patients manage their cholesterol levels with healthy lifestyle changes and medication when needed. Quick facts about cholesterol Cholesterol is a waxy substance that plays an important role in cell and organ health and function. We need some cholesterol in order to maintain those functions, and fortunately, our body is capable of producing all the cholesterol we need to stay healthy. Cholesterol is also found in many foods — specifically, foods derived from animals. If we consume too much cholesterol, the extra cholesterol builds up in our bloodstream, sometimes collecting along the walls of our arteries and interfering with normal blood flow. In fact, high cholesterol levels can lead to a condition called atherosclerosis or “hardening” of the arteries. When cholesterol builds up inside our arteries, it narrows the space for blood flow while also making arteries less flexible and less able to keep blood moving the way it’s supposed to. Over time, the cholesterol deposits (or plaques) can prevent adequate oxygen and nutrients from reaching your organs (like your heart) or your limbs. Atherosclerosis is the primary cause of coronary artery disease and peripheral artery disease, two very serious medical complications that can take a major toll on your health and your quality of life. HDL vs. LDL: What to know Cholesterol is sometimes called “good” and “bad” cholesterol, which is a misnomer. “Bad” cholesterol refers to low-density lipoproteins or LDL. This type of cholesterol sticks to artery walls and forms plaques that lead to atherosclerosis. “Good” cholesterol refers to high-density lipoproteins or HDL. HDL gets its “good” reputation because it helps eliminate LDL plaques, carrying some of the LDL cholesterol back to your liver where it can be processed and used or eliminated. Although LDL can increase your risk of health problems, the truth is that LDL is not entirely “bad” — we need some for our cells to function. However, keeping both LDL and HDL within a healthy range is essential to reduce the likelihood of those problems. Ideal ranges Cholesterol levels are measured with a simple blood test. The test gives you values that reflect your cholesterol levels. Under current guidelines, healthy cholesterol levels are: LDL: less than 100 mg/dL HDL: 40 mg/dL or higher for men; 50 mg/dL or higher for women Total cholesterol: 200 mg/dL or lower It’s important to note that these values are for people in good general health. If you have hypertension, diabetes, or other chronic diseases or risk factors, your recommended values can be different. Managing your cholesterol levels Genetics play a big role in determining your HDL levels, but you can improve those levels by: Quitting smoking Adopting a healthy diet Engaging in aerobic exercise on a regular basis While HDL helps reduce the effects of LDL, extremely high levels of HDL can also be bad for your health. For LDL, both lifestyle factors and medication can play important roles in managing your levels. ideally, you’ll keep levels within a healthy range with simple but important changes, like: Managing your weight Getting plenty of aerobic exercise Eating a heart-healthy diet low in unhealthy fats Managing underlying health problems, like hypertension When these options aren’t enough, medications like statins can help lower your LDL levels and may provide a modest increase in HDL, too. Don’t leave your cholesterol up to chance High cholesterol rarely causes symptoms before serious problems develop, so regular cholesterol screening is vital for your health. To check your cholesterol or find out how we can help you manage your cholesterol levels, call 561-658-1522 to request an appointment with the team at Nguyen Medical Group in Boynton Beach, Florida, today. You Might Also Enjoy... Comprehensive Senior Care: 5 Invaluable Benefits of Medication Management When you enter your senior years, your medical needs can become more complex than when you were younger. Learn 5 important benefits seniors get from medication management. Skin Tags and Diabetes: What's the Connection? If you have diabetes, it can affect your body in all kinds of unexpected ways. Read on to learn about the connection between skin tags and diabetes and what you can do. 5 Subtle Signs of an Underactive Thyroid in Women If you’re a woman with hypothyroidism, it can be easy to attribute its symptoms to conditions like menopause, your menstrual cycle, or even stress. In women, these 5 subtle symptoms can indicate you have an underactive thyroid. Understanding How Uncontrolled Hypertension Affects Your Kidneys Alongside the risk of heart damage, uncontrolled hypertension can hurt other organs. In recognition of World Hypertension Day on May 17, learn more about how uncontrolled hypertension harms your kidneys and what you can do. The Role of Insulin In Your Body Insulin is one of the most important chemicals your body produces. Thanks to insulin, your body can complete many essential functions. Learn about the role of insulin in your body and treatment for insulin resistance. What Happens If I Miss My Annual Physical? There’s nothing better than having the peace of mind that you’re in good health and the tools to help you continue that way by attending an annual physical. Understand what happens if you miss your annual physical and what to do.
1850
dbpedia
1
74
https://www.betterhealth.vic.gov.au/health/conditionsandtreatments/triglycerides
en
Triglycerides
https://www.betterhealth…mg/bhc-ogimg.png
https://www.betterhealth…mg/bhc-ogimg.png
[ "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/logo.png", "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/dhlogo.png", "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/logo.png", "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/dhlogo.png", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png", "https://content.dhhs.vic.gov.au/sites/default/files/logo-Baker.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png", "https://content.dhhs.vic.gov.au/sites/default/files/logo-Baker.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png", "https://content.dhhs.vic.gov.au/sites/default/files/logo-Baker.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/flag-torres-strait.8fc9c3c.png", "https://www.betterhealth.vic.gov.au/_nuxt/img/pride-progress-flag.c1c6916.png", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DHHS.8d8f412.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/footer-logo.c95ca18.png" ]
[]
[]
[ "alcoholism", "artherosclerosis", "atheroschlerosis", "atherosclerosis", "cholesteral", "cholesterol", "diabetes", "dietary cholesterol", "dietary fat", "dietary fats", "familial hypertriglyceridemia", "fat", "fat content in food", "fats", "fatty plaques", "good fats", "heart desease", "h" ]
null
[]
2009-06-11T00:00:00
If a person habitually eats more kilojoules than they burn, they will have raised triglyceride levels in the blood.
en
/favicon.ico
http://www.betterhealth.vic.gov.au/health/conditionsandtreatments/triglycerides
Triglycerides are a common type of fat that accounts for about 95 per cent of all dietary fats. Both animal and vegetable fats contain triglycerides. Once digested, triglycerides circulate in the bloodstream to be used as energy by the cells. Any leftovers are stored in body fat to fuel the body between meals. If you regularly eat more kilojoules than you burn, you will be overweight or obese and may have raised triglyceride levels circulating in your blood. High blood triglycerides are linked with an increased risk of health conditions including heart disease. High triglycerides are also known as hypertriglyceridemia. Metabolic syndrome – risk factors High triglyceride levels are associated with a collection of disorders known as ‘metabolic syndrome’. A person with metabolic syndrome has an increased risk of developing diabetes, stroke or heart disease. A person is classed as having metabolic syndrome when they have any three of the following factors: Central (abdominal) obesity – excess fat in and around the stomach (abdomen) High blood pressure (hypertension) Higher than normal blood glucose levels Low HDL (high density lipoprotein) cholesterol High blood triglycerides. Triglycerides and cholesterol Like triglycerides, cholesterol is a fatty substance that circulates in the blood. However, the body uses triglycerides and cholesterol differently. Triglycerides are a type of fuel, while cholesterol is needed for various metabolic processes such as making particular hormones and building cells. The two types of cholesterol are high density lipoprotein (HDL) and low density lipoprotein (LDL). Over time, raised LDL causes fatty plaques to form on blood vessel walls. This process is called atherosclerosis. Blood flow is restricted through these narrowed blood vessels. A complete blockage can cause life-threatening conditions including heart attack or stroke. High triglycerides contribute to the development of atherosclerosis. Studies show that many people with high triglycerides have low levels of HDL – the ‘good’ cholesterol that helps remove fat from the artery. Low HDL levels are a known risk factor in the development of heart disease. Causes of high triglycerides In many cases, habitual overeating causes high triglycerides. Occasionally, the trigger is an underlying condition such as: Excessive alcohol consumption Adverse side effect of particular medications Poorly managed diabetes Hypothyroidism (insufficient production of thyroid hormones) Some types of liver disease Some types of kidney disease Some genetic disorders, including the inherited disease familial hypertriglyceridemia and familial combined hyperlipidemia (triglyceride and LDL are both elevated). Diagnosis of high triglycerides A blood test can reveal whether or not you have high triglycerides. You may need to have two (or more) blood tests for accurate results. Don’t eat anything for at least 12 hours before each blood test because food – particularly fatty food – can temporarily boost triglyceride levels in the blood and skew your test results. Triglycerides are measured in mmol/L. The range includes: Very high – over 6 mmol/L High – between 2 and 6 mmol/L Borderline high between 1.7 and 2 mmol/L Normal – below 1.7 mmol/L The doctor may also test your cholesterol levels. In many cases, high triglycerides and high cholesterol go hand in hand. This condition is sometimes known as combined hyperlipidemia. Treatment of high triglycerides In most cases, high triglycerides are managed by making lifestyle changes. You may be advised to: Exercise for at least 30 minutes every day. Eat less, particularly high fat foods. Increase the amount of fibre in your diet. Avoid high sugar foods such as lollies. Choose foods with a low glycaemic index (GI) such as legumes and wholegrain products. Eat more fish. Choose fish rich in omega-3 fatty acids such as salmon, mackerel, tuna and trout. Omega-3 in high doses can reduce triglyceride levels. Cut back on alcohol. The kilojoules and sugar in alcoholic drinks can raise triglyceride levels. Lose excess body fat using a combination of healthy eating and regular exercise. Don’t smoke. Manage coexisting health conditions such as diabetes or hypertension effectively. Medications may be needed for high triglyceride levels Sometimes, healthy eating and regular exercise can’t lower high triglyceride levels. This may be the case, for example, if you have familial hypertriglyceridemia or if you already have heart disease. Your doctor may prescribe medication such as fibrates or nicotinic acids. Drugs to help lower high blood cholesterol may also be prescribed, if necessary. Suggestions for managing high triglyceride levels with medication include: Always take prescription medications exactly as instructed. See your doctor if you are having side effects from the medication. Known medication side effects may include indigestion, diarrhoea, fever or muscle problems. Don’t assume that medications will somehow overcome the hazards of an unhealthy lifestyle. A healthy diet, regular exercise and maintaining an appropriate weight for your height are the most important management strategies for high triglycerides. Where to get help
1850
dbpedia
0
38
https://europepmc.org/article/med/27338940
en
Europe PMC
https://europepmc.org/images/favicon.ico
https://europepmc.org/images/favicon.ico
[]
[]
[]
[ "Europe PMC", "Europe PubMed Central", "open access", "research articles", "journal articles", "abstracts", "full text", "literature search", "clinical guidelines", "biological patents", "life sciences", "bioinformatics", "biomedical research", "citation search", "biomedical journals", "ORCIDs", "text mining", "citation networks", "REST APIs" ]
null
[ "Europe PMC" ]
null
Europe PMC is an archive of life sciences journal literature.
en
/images/favicon.ico
null
Europe PMC requires Javascript to function effectively. Either your web browser doesn't support Javascript or it is currently turned off. In the latter case, please turn on Javascript support in your web browser and reload this page.
1850
dbpedia
0
18
https://atm.amegroups.org/article/view/33740/html
en
Clinical features and genetic characteristics of hereditary diffuse leukoencephalopathy with spheroids due to CSF1R mutation: a case report and literature review
https://cdn.amegroups.cn…icon-144x144.png
https://cdn.amegroups.cn…icon-144x144.png
[ "https://cdn.amegroups.cn/static/image/a3e8cbcd5328931f57f575ab2d324443/a3e8cbcd5328931f57f575ab2d324443.png/w1400", "https://cdn.amegroups.cn/static/mirror/crossmark/widget/v2.0/CROSSMARK_Color_horizontal.svg", "https://cdn.amegroups.cn/journals/amepc/files/journals/16/articles/33740/public/33740-PB4-8235-R1.png/w300", "https://cdn.amegroups.cn/journals/amepc/files/journals/16/articles/33740/public/33740-PB6-6954-R1.png/w300", "https://cdn.amegroups.cn/journals/amepc/files/journals/16/articles/33740/public/33740-PB3-4550-R1.png/w300", "https://cdn.amegroups.cn/journals/amepc/files/journals/16/articles/33740/public/33740-PB5-8468-R1.png/w300", "https://cdn.amegroups.cn/static/image/41bc1963fd89d68b77ed544999f514f0.png/w300", "https://cdn.amegroups.cn/static/image/5945e34c7a75afe40a8f7f6fa4a01e7a/get-permission-btn-big.png/w150" ]
[]
[]
[ "" ]
null
[ "Lv-Ping Zhuang", "Chang-Yun Liu", "Yuan-Xiao Li", "Hua-Ping Huang", "Zhang-Yu Zou" ]
null
Clinical features and genetic characteristics of hereditary diffuse leukoencephalopathy with spheroids due to CSF1R mutation: a case report and literature review
en
//cdn.amegroups.cn/journals/amepc/images/atm/favicon.ico
null
Introduction Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant disease that causes adult-onset cognitive impairment, behavioral or emotional changes, paresis, Parkinsonism, and seizures (1). In 1984, Axelsson et al. first reported a family with HDLS (2). In 2011, mutations in the colony-stimulating factor 1 receptor (CSF1R) were identified as the cause of HDLS (3). Thereafter, CSF1R mutations linked two previously separate disease entities, HDLS and pigmented orthochromatic leukodystrophy, as a single disease (4). Patients with HDLS show significant variability in phenotypes; therefore, these patients have often been misdiagnosed with other diseases. To date, more than 60 CSF1R mutations have been reported. Most patients with HDLS caused by CSF1R mutations were identified in Japanese, European, and American populations (5). Here we report a Chinese patient with HDLS due to a novel CSF1R mutation. We also review all patients with HDLS reported in the literature and summarize the clinical, brain imaging and genetic characteristics of HDLS. Methods Case report The index patient (III-3) (Figure 1A) was a 40-year-old male who was referred because of progressive right leg paresis and cognitive impairment. He presented with weakness of the right lower limb three months before admission. Memory decline was also noticed. Two months before admission, ambiguous and vague speech began to emerge. On neurological examination, there was limited abduction of both eyes, with decreased gap reflex. Muscle strength of the right lower limb was grade 4, muscle tone was increased in all extremities, and deep tendon reflexes were hyperactive in all limbs, with bilateral positive Babinski sign. Sensory system was normal. His Mini-Mental State Examination score was 25/30 and Montreal Cognitive Assessment score was 20/30. Notably, his mother (II-9) and aunt (II-5) had similar clinical symptoms of hemiparalysis and died at middle age (Figure 1A). Brain MRI showed bilateral white matter lesions in bi-frontoparietal and periventricular areas; hyperintense on T2-weighted (Figure 1B), FLAIR and diffusion weighted images (DWI) (Figure 1C); hypointense on T1-weighted and apparent diffusion coefficient (ADC) images (Figure 1D); and no obvious microhemorrhage in SWI images. Thinning of corpus callosum was also seen (Figure 1E). No enhanced lesions were seen in the enhancement sequence. MRA did not show obvious abnormalities (Figure 1F). The routine and biochemical results of cerebrospinal fluid were normal. Serum anti-NMO, anti-MBP, and anti-MOG antibody levels were negative. Serum ANA+ANA antibodies, ANCA, PR3 and MPO antibodies were negative. On the last follow up at one and a half year after onset, he was bedridden because of rigidity of the extremities, with dysphagia with tube feeding, severe dysarthria, and obvious dementia, and the patient could hardly communicate with his family. Next generation sequencing revealed a novel heterozygous variation, c.1952G>A (p.G651E), in the CSF1R gene (Figure 1G). In silico analysis of this variation using multiple prediction programs [PolyPhen-2 (http://genetics.bwh.havard.edu/pph2), MutationTaster (www.mutationtaster.org), MutPred (http://mutpred.org)] consistently predicted the variant as damaging. Segregation analysis of the mutation was not feasible due to deceased or unreachable relatives of the proband. Literature review We conducted a literature search in Medline, EMBASE, WANFANG (old.g.wanfangdata.com.cn) and CNKI (www.cnki.net) using the following keywords: “hereditary diffuse leukoencephalopathy with spheroids” or “HDLS”. Only English and Chinese language literature were included in the review. The diagnosis of HDLS was required to be based on both clinical features and genetic tests. We extracted the following information from the relevant papers: first author, year of study, population, sex, age, clinical features, brain imaging findings, genetic characteristics and family history. Results Clinical features Overall, 137 patients with HDLS from 102 families were identified (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). The main clinical features of these patients are summarized in Table 1. The average age of onset was 43.3 years (range, 10–71 years). There was no sex difference in age of onset (43.3 years for female vs. 43.2 years for male). Patients were mainly European (36 families), American (26 families) and Japanese (23 families); only 10 families were Chinese (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). The most common symptoms of HDLS were cognitive impairment (87%), followed by psychiatric symptoms (55%), Parkinsonism (41%), gait disorder (34%), and dysphagia (34%) (Table 1). Other symptoms included hemiplegia, seizures, speech disorder, apraxia, urinary incontinence, dysarthria, tremor, and nystagmus. Psychiatric symptoms such as anxiety, depression, apathy, indifference, abulia, irritability, disinhibition, distraction and other behavioral and personality changes were also reported (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). The mean survival was 6.2 years (range, 1–29 years), with no difference in survival according to sex of patients (5.9 years for female vs. 5.5 years for male). Brain imaging features The brain images of 103 out of 137 patients with HDLS were available. The main features of brain images of these patients are summarized in Table 2. The most common brain imaging findings of HDLS were bilateral white matter lesion (90%), mostly around the ventricles (67%), frontal lobe (29%), and parietal lobe (27%). Calcifications in white matter on CT (64%), cerebral atrophy (37%) and thinning of corpus callosum (35%) were also common features. Other findings include dilation of the lateral ventricles and abnormal signals in the corpus callosum, brainstem and spinal cord. Genetic features Among the total HDLS cases, 101 cases (65% of all families) had a definite family history. A total of 80 mutations in CSF1R have been reported (Figure 2), including 63 missense mutations, one nonsense mutation, two insertion/deletion mutations, five frameshift mutations, and nine splicing mutations. All mutations except for a missense mutation p.G17C and three frameshift mutations, p.P104Lfs*8, p.T567fs*44 and p.970Sfs*108, are located in the tyrosine kinase domain (TKD) of CSF1R protein, encoded by exons 12–21 of the gene. Mutations were more frequent in the distal TKD region encoded by exons 17–21 (53 mutations) than in the proximal TKD region encoded by exons 12–15 (14 mutations). Mutations hotspots were observed in exons 18–20, where 43 CSF1R mutations are located (Figure 2). Discussion In this study, we identified a novel missense mutation p.G651E in the CSF1R gene in a patient presenting with adult-onset leukoencephalopathy, cognitive impairment and motor dysfunction. G651 is highly conserved across species (Figure 1H) and lies in the TKD domain, the critical domain of CSF1R (PM1). The p.G651H variant was absent from the control databases (gnomAD, 1000 Genomes Project, ClinVar) (PM2). In silico tools indicated the variant was deleterious (PP3), and the patient’s phenotype and family history are highly specific for a disease with a single genetic etiology (PP4). Therefore, according to the guidelines of the American College of Medical Genetics and Genomics for sequence variant interpretation, the p.G651E variant was interpreted as likely pathogenic (6). The patient had the core features of HDLS: age at onset ≤60 years, cognitive impairment and pyramidal signs, autosomal dominant inheritance, bilateral cerebral white matter lesions and thinning of the corpus callosum in brain MRI images. He also carried a CSF1R gene mutation. Therefore, a diagnosis of definite HDLS can be made according to the diagnostic criteria (7). Our review showed that average age of onset of patients with HDLS is 43 years; however, the onset age can vary from 10 to 71 years. This disease is clinically characterized by two groups of symptoms: neuropsychiatric and motor symptoms (8). The neuropsychiatric symptoms include memory impairment, progressive cognitive decline, depression, apathy, anxiety, and other behavioral or personality changes. Motor symptoms include Parkinsonism, pyramidal signs, dysarthria, dysphagia, and ataxia (8). The most common clinical characteristic of patients with HDLS is cognitive impairment (84%), followed by psychiatric symptoms, Parkinsonism, gait disorders, and dysphagia. The neuroradiographic characteristics of patients with HDLS are bilateral but asymmetric T2-weighted and FLAIR hyperintensities in the deep and subcortical white matter, predominantly in the frontal, frontoparietal, and periventricular areas (Table 2) (5,8). Early lesions are patchy and focal, but with time spread around and become confluent. The preferential involvement of the frontal white matter may account for the predominant cognitive impairment and psychiatric symptoms in patients with HDLS. Diffusion-restricted lesions with reduced ADC can be observed in the white matter and can be persistent for several months or more, which can be differentiated from stroke. There was no enhancement and microbleeding. Thinning of the corpus callosum, cerebral atrophy and dilation of the lateral ventricles is typical, even in the early phases of the disease. Calcifications in the white matter on CT scan are characteristic imaging features of HDLS and demonstrate a “stepping stone appearance” in the frontal pericallosal area and punctate appearance in the frontal white matter adjacent to the anterior horns of the lateral ventricles (8). It should be noted that neuroradiographical abnormalities could precede the presence of clinical symptoms. At least three asymptomatic CSF1R mutation carriers with subtle T2 hyperintensities or bilateral white matter lesion, abnormal signals in lateral ventricle and frontal lobe have been reported (9,10). So far, there have been no obvious genotype-phenotype correlations regarding HDLS, with some family members showing significant differences in disease presentation and course within the same family. Therefore, the clinical symptoms of patients with HDLS are variable and easily misdiagnosed with other diseases. Patients with HDLS presented with cognitive decline and personality changes in midlife with a progressive course, and evident white matter lesions on MRI should be differentiated with other leukoencephalopathy, such as adult-onset autosomal dominant leukodystrophy, Alexander disease, or cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Patients with predominant motor symptoms are easily misdiagnosed as multiple sclerosis, especially during the earliest phases of the disease (1). Recently, Konno et al proposed a diagnostic criterion for CSF1R-related leukoencephalopathy. The criteria yield high sensitivity (96%) and can successfully exclude other leukoencephalopathy. If a patient fulfills the probable criteria, genetic testing for CSF1R should be performed (7). The mean disease duration for patients with HDLS was 6.2 years (Table 1). However, the rate of progression varies among individuals and patients may develop a rapid progression or a very slow progression (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). Indicators of rapid disease progression of patients with HDLS were symptomatic disease onset before 45 years, female, white matter lesions extending beyond the frontal regions, an MRI severity score based on a point system [0–57] greater than 15 points, and mutation type of deletion (11). Although HDLS is usually inherited in an autosomal dominant pattern, 36% of HDLS cases were apparent sporadic cases (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). However, whether these sporadic cases reflect incomplete or non-penetrance or were caused by de novo mutations in the CSF1R gene remains unknown. The HDLS pedigrees reported so far showed that mutations in CSF1R have a high penetrance, but in one family carrying the CSF1R p.Q877X mutation and another p.V784M mutated pedigree, the index patient was severely affected since the age of 28 years whereas their parents who carried the same CSF1R mutation still had no neurological symptoms at 69 years and 79 years, suggesting incomplete penetrance in HDLS (9,12). In addition, three confirmed de novo CSF1R mutations (3,9) and two apparent (without paternity confirmation) de novo CSF1R mutations (13,14) have been reported in patients with HDLS, suggesting at least some patients with HDLS are true sporadic and caused by de novo mutations in the CSF1R gene. CSF1R is an essential factor for development and maintenance of microglia. Approximately 95% of CSF1R mutations in HDLS are located within the TKD (Figure 2), suggesting that loss of tyrosine kinase activity may be necessary for the development of HDLS. Reduced expression of CSF1R was also observed in brains of patients with missense and splice-site mutations, indicating that any type of CSF1R mutation may cause HDLS by haploinsufficiency (4,15) (Figure 2). A mutant CSF1R mouse strain with a haploinsufficient allele developed HDLS-like symptoms, including cognitive decline, behavioral changes, and motor symptoms. White matter abnormalities, enlargement of the lateral ventricles, and thinning of the corpus callosum were also evident on MRI. The mouse model provides strong evidence that CSF1R haploinsufficiency is enough to cause white matter degeneration (16). However, marginally elevated cell surface CSF1 receptor levels with increased Tyr723 autophosphorylation was observed in a HDLS patient with CSF1R p.I843_L844delinsGI mutation, suggesting a mutation-related CSF1R gain-of-function (17). Notably, mutations tend to occur more frequently in the distal part of the TKD than the proximal part (5), and exons 18­–­20 of CSF1R gene are mutation hotspots where 63% of CSF1R mutations exist (Figure 2). Further functional experiments are needed to elucidate the pathogenesis of CSF1R mutations. In conclusion, HDLS typically presents with broad phenotypic variability, and although it demonstrates an autosomal dominant pattern, sporadic cases are not uncommon. Early recognition of clinical and neuroradiographical characteristics of HDLS is key for the correct diagnosis of the disease, given the poor prognosis, rapid course, and genetic testing implications for family members. Acknowledgments The authors sincerely appreciate the participants for their help and willingness to participate in this study. Conflicts of Interest: The authors have no conflicts of interest to declare. Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The patient gave an informed consent before taking part. References Sundal C, Wszolek ZK. CSF1R-Related Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia. In: Adam MP, Ardinger HH, Pagon RA, et al. editors. GeneReviews((R)). Seattle (WA): University of Washington, Seattle University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle.; 1993. Axelsson R, Roytta M, Sourander P, et al. Hereditary diffuse leucoencephalopathy with spheroids. Acta Psychiatr Scand Suppl 1984;314:1-65. [PubMed] Rademakers R, Baker M, Nicholson AM, et al. Mutations in the colony stimulating factor 1 receptor (CSF1R) gene cause hereditary diffuse leukoencephalopathy with spheroids. Nat Genet 2011;44:200-5. [Crossref] [PubMed] Nicholson AM, Baker MC, Finch NA, et al. CSF1R mutations link POLD and HDLS as a single disease entity. Neurology 2013;80:1033-40. [Crossref] [PubMed] Konno T, Yoshida K, Mizuno T, et al. Clinical and genetic characterization of adult-onset leukoencephalopathy with axonal spheroids and pigmented glia associated with CSF1R mutation. Eur J Neurol 2017;24:37-45. [Crossref] [PubMed] Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015;17:405-24. [Crossref] [PubMed] Konno T, Yoshida K, Mizuta I, et al. Diagnostic criteria for adult-onset leukoencephalopathy with axonal spheroids and pigmented glia due to CSF1R mutation. Eur J Neurol 2018;25:142-7. [Crossref] [PubMed] Konno T, Kasanuki K, Ikeuchi T, et al. CSF1R-related leukoencephalopathy: A major player in primary microgliopathies. Neurology 2018;91:1092-104. [Crossref] [PubMed] Karle KN, Biskup S, Schule R, et al. De novo mutations in hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS). Neurology 2013;81:2039-44. [Crossref] [PubMed] Bai Y, Lu L, Cui Y, et al. Analysis of clinical and neuroimaging features in a Chinese family with hereditary diffuse leukoencephalopathy with neuroaxonal spheroids. Chin J Neurol 2018;51:877-81. Sundal C, Van Gerpen JA, Nicholson AM, et al. MRI characteristics and scoring in HDLS due to CSF1R gene mutations. Neurology 2012;79:566-74. [Crossref] [PubMed] La Piana R, Webber A, Guiot MC, et al. A novel mutation in the CSF1R gene causes a variable leukoencephalopathy with spheroids. Neurogenetics 2014;15:289-94. [Crossref] [PubMed] Kondo Y, Kinoshita M, Fukushima K, et al. Early involvement of the corpus callosum in a patient with hereditary diffuse leukoencephalopathy with spheroids carrying the de novo K793T mutation of CSF1R. Intern Med 2013;52:503-6. [Crossref] [PubMed] Saitoh BY, Yamasaki R, Hayashi S, et al. A case of hereditary diffuse leukoencephalopathy with axonal spheroids caused by a de novo mutation in CSF1R masquerading as primary progressive multiple sclerosis. Mult Scler 2013;19:1367-70. [Crossref] [PubMed] Konno T, Tada M, Tada M, et al. Haploinsufficiency of CSF-1R and clinicopathologic characterization in patients with HDLS. Neurology 2014;82:139-48. [Crossref] [PubMed] Chitu V, Gokhan S, Gulinello M, et al. Phenotypic characterization of a Csf1r haploinsufficient mouse model of adult-onset leukodystrophy with axonal spheroids and pigmented glia (ALSP). Neurobiol Dis 2015;74:219-28. [Crossref] [PubMed] Kraya T, Quandt D, Pfirrmann T, et al. Functional characterization of a novel CSF1R mutation causing hereditary diffuse leukoencephalopathy with spheroids. Mol Genet Genomic Med 2019;7:e00595. [Crossref] [PubMed]
1850
dbpedia
1
0
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/
en
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS): a misdiagnosed disease entity
https://www.ncbi.nlm.nih…rd-share.jpg?_=0
https://www.ncbi.nlm.nih…rd-share.jpg?_=0
[ "https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png", "https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg", "https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg", "https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg", "https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/logo-nihpa.png", "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/bin/nihms-331541-f0001.jpg", "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/bin/nihms-331541-f0002.jpg", "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/bin/nihms-331541-f0003.jpg" ]
[]
[]
[ "" ]
null
[ "Christina Sundal", "Jennifer Lash", "Jan Aasly", "Sarka Ø ygarden", "Sigrun Roeber", "Hans Kretzschman", "James Y. Garbern", "Alex Tselis", "Rosa Rademakers", "Dennis W. Dickson" ]
2012-03-15T00:00:00
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) was originally described in a large Swedish pedigree. Since then, 22 reports describing a total of 13 kindred's and 11 sporadic cases have been published. Inheritance is autosomal dominant, ...
en
https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/favicons/favicon.ico
PubMed Central (PMC)
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/
Introduction Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) was first identified in a Western Swedish family reported in 1984 [1]. There have been 13 kindreds [2–5] and 11 sporadic cases [2, 6–9] since that first report. HDLS is probably closely related to familial pigmentary orthochromatic leukodystrophy (POLD) or is within the same disease spectrum [2]. The pathological hallmark of this disease is the presence of brain white matter changes with neuroaxonal spheroids present [1]. Inheritance is autosomal dominant with variable penetrance, but the causative genes are unknown. HDLS is characterized by a constellation of symptoms including personality changes, cognitive dysfunction and motor impairments such as gait dysfunction, tremor, bradykinesia and rigidity. Brain MRI shows white matter lesions in a frontal predominant distribution, spreading out from the periventricular and deep white matter into the subcortical areas with enlarged ventricles and often signal changes in corpus callosum. Van Gerpen et al. reported a HDLS case with serial MRI's. In the presymptomatic stage, MRI demonstrated subtle patchy abnormalities in the periventricular white matter, which later on subsequent MRI, performed when patient was in advance stage of disease, became widespread and confluent [3]. This important observation suggests that the disease process in the brain starts locally and then becomes more widespread with disease progression. An international consortium on HDLS was established in 2005 by one of the authors (ZKW) after the first Mayo Clinic kindred with HDLS was reported [10]. Since then, 14 additional families have been collected at the Mayo Clinic and 4 have been reported [2, 3]. In our research study brains and brain biopsy specimens have been collected both retrospectively and prospectively. All have been examined by DWD, and only those demonstrating pathological features of HDLS were included in our study. Based on our collection we found that all of the 20 cases were misdiagnosed (unpublished data). Therefore, we describe here the HDLS cases from the smallest families as the evidence of familial clustering indicating a genetic disorder is not always obvious. Phenotypic variability may occur in the affected members of a given kindred, and can misleadingly be interpreted as two unrelated sporadic disorders. Diagnoses of HDLS in small families can therefore be challenging and particularly difficult since there is often not a convincing family history. However, there is strong evidence that HDLS is a genetic disorder due to the larger families, both reported and unpublished, who show an autosomal dominant heredity [1, 3, 10]. Based on our Mayo Clinic HDLS collection and published reports, HDLS patients may be misdiagnosed with Alzheimer's disease (AD), frontotemporal dementia (FTD), atypical parkinsonism (AP), multiple sclerosis (MS) and/or small vessel diseases. Herein we report three new HDLS families to increase the awareness of this disorder and discuss the differential diagnoses from the clinical, imaging, and pathological perspective. Results Short case reports are provided below. Summary of the clinical characteristics and laboratory investigations of our probands are provided in . Pedigrees are presented in Table 1 Case #SexOnset Age (yrs)Age at Death (yrs)Years with HDLSInitial SymptomsLater SymptomsAdditional FeaturesLaboratory investigationsDifferential Diagnosis1F38413-Depression -Personality changes -Cognitive problems-Apraxia -Bradykinesia, -Shuffling gait -Homonymous hemianopsia -Spasticity -Tetraparesis -Mutism -Dysphagia-Seizure -Alien limb sign-Routine blood and urine tests -Amino acids, VDRL, HIV serologies ArylsutfataseA, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase, very long chain fatty acids -Anti-nuclear, anti-neutrophil cytoplasmic-/ anti-neuronal nuclear antibodies -Cerebrospinal fluid examination -CADASIL skin biopsy test and NOTCH 3 gene test -Mitochondrial muscle biopsies -All test were normal-Atypical MS2F36404-Dizziness -Executive dysfunction -Depression -Personality changes -Cognitive problems-Apraxia -Bradykinesia -Spastic broad-based gait -Homonymous quadrantanopsia -Spasticity -Tetraparesis -Dysphasia -Dysphagia-Seizure -Dystonia-Routine blood and urine tests -Amino acids, VDRL, HIV serologies -ArylsulfataseA, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase, very long chain fatty acids -Anti-nuclear, anti-neutrophil cytoplasmic-/ anti-neuronal nuclear antibodies -Cerebrospinal fluid examination -CADASIL skin biopsy test and NOTCH3 gene test -Mitochondrial muscle biopsies -All tests were normal-Atypical MS3M526311-Personality changes -Cognitive problems -Memory problems-Reduced proprioceptions -Paresis in arm -Vertical gaze palsy -Ataxic and shuffling gait -Bradykinesia -Tetraparesis-Myoclouus finger movements -Palatal and arms tremor-Routine blood and unine tests -Amino acids, VDRL, HIV, syphilis serologies -Antinuclear-, antineutrophil cytoplasmic-/ antineuronal nuclear antibodies -Lead and copper -Cortisol -Unine organic acids and lactate -CSF -Nerve conduction study -CADASIL skin biopsy test -All tests were normal (except a slight protein elevation in CSF)-No specific final clinical diagnosis was made but: AD. Atypical CADASIL Atypical MS were considered 4M48Patient still livingPatient still living-Parkinsonism -Personality changes-Slow saccadic eye movements -Shuffling gait -Bradykinesia -Kinetic tremor -Rigidity -Dysarthria -Dysphagia-Occulomotor appraxia -Hypophonic speech-Routine blood and urine tests -Ceruloplasmin and lactate -Pyruvate -Aminoacids, VDRL, TPHA, Lyme,Brucella screens, HIV and NMO antigene -Antinuclear-, antineutrophil cytoplasmic-/ autineuronal nuclear antibodies -Urinary organic acids -ACE (serum and CSF) Arylsulfatase A, galactocerebrosidase, beta-galactosidase, hexosaminidase, sphingomyelinase, and very long chain fatty acids -CSF examination -CADASIL skin biopsy test and NOTCH3 gene test -Paraneoplastic panel -Malignancy screening with PET -Genetic analyses for Parkin, PINKI, LRRK2 -Nerve conduction study -EMG -All test were normal-No specific final clinical diagnosis was made but: NMO Atypical PD MS PSP(PSP superimposed on MS) were considered Case 1. (Norwegian family) A 38-year-old female developed depression, difficulties with following directions and performing calculations, slowness of thoughts and fatigue. Due to progressive cognitive dysfunction, she had difficulties continuing her work as a mail carrier. During the first evaluation, approximately six months after symptom onset, she had slight bradykinesia in all extremities, which was more evident on her right side. She also had exaggerated deep tendon reflexes, but no extensor plantar responses. An axial T2-weighted brain MRI was performed 1.2 years after the onset of her symptoms and showed localized white matter T2 hyperintense foci in the bifrontal and biparietal white matter (more on the left) and corpus callosum, with associated atrophy ( ). Clinical examination, at the time of the MRI, demonstrated increased bradykinesia in all extremities, slight apraxia, unsteady broad based gait and extensor plantar response on the right side. Over the next nine months, there was rapid deterioration of cognitive and motor functions with spasticity and multiple falls. She developed primitive reflexes, homonymous hemianopsia to the right side, alien limb sign in her right arm, mutism, somnolence and generalized tonic- clonic seizures. She became bedridden about six months before passing away at the age of 41, after a 3 year disease course. She was treated with intermittent regimes with intravenous (IV) methylprednisolone sodium succinate 1000 mg given in three consecutive days followed by oral prednisolone 60 mg daily with downward titration over 3 weeks. This therapy was repeated every two months three times over the course of her illness. No benefit was seen. Her clinical diagnosis was atypical MS. Case 2. (Norwegian family) The identical twin sister of Case 1 had similar symptoms and disease course. Her symptoms started insidiously with attacks of dizziness at age 36 and lasting intermittently for the following year. Subsequently, at the age of 37 year old, she developed executive dysfunction, depression, memory problems, reduced fine skill movements, clumsiness and stiffness in her left arm. Two years after the onset of her symptoms she was found to have left sided arm dystonia, left sided dysmetria, generalized bradykinesia, slight apraxia, exaggerated tendon reflexes and a positive bilateral extensor plantar responses. Her gait was spastic and she had left inferior homonymous quadrantanopsia. Over the next few months she developed generalized seizures, spasticity in all four extremities, tetraparesis, contractures of the large joints in both upper and lower extremities, dysphasia, dysphagia, and became totally bedridden. A brain MRI, axial T2-weighted, performed 1.9 years after the onset of symptoms demonstrated confluent bifrontal and biparietal white matter (more marked on the right) T2 hyperintensities with corresponding atrophy ( ). She was treated with steroids followed the same protocol as for her sister. However, after completion of steroid therapy without any benefit, she was placed on subcutaneous interferon beta-1a (IFN-1a), 44 μg, three times weekly for six months. These provided no benefit. She died at 40 years of age. Her final clinical diagnosis was atypical MS. Both sisters had negative routine blood and urine tests. Amino acids, VDRL and HIV serologies, arylsulfatase A, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase, very long chain fatty acids, anti-nuclear, anti-neutrophil cytoplasmic, and anti-neuronal nuclear antibodies were all negative. Cerebrospinal fluid examination, CADASIL skin biopsy and NOTCH3 blood test and mitochondrial muscle biopsies were also normal. Autopsies demonstrated brain white matter abnormalities with axonal spheroids that were immunohistochemistry-positive for neurofilament and amyloid precursor protein, similarly to other reported cases of HDLS [10] ( ). Both patients also had corticospinal tract degeneration. Contrarily, their parents are alive and healthy and there are no other affected family members. Case 3. (German family) A 52-year-old male developed personality and memory problems over a period of three months. He lost interest in daily activities, became withdrawn and aggressive. At neurological examination, three months after symptom start, no focal abnormalities were detected, with the exception of mini-mental state examination (MMSE) score of 24/30 points. Over the next 10 years, he developed insidious increase of symptoms with reduced vibration sensation in all extremities, finger myoclonus, vertical gaze palsy, brisk reflexes and upper motor neuron weakness in the right arm. Tremor was present in both arms and palate. The gait became ataxic with small steps; he also became doubly incontinent and became totally ADL dependent. In the last year of the disease he had reached a vegetative state; was totally bedridden and mute. He died 11 years after the onset of the first symptom. Laboratory investigations including serum electrolytes; complete blood counts; liver and thyroid function tests; vitamin B12 and folate levels; vitamin E; cholesterol and triglycerides; amino acids (serum and urine); syphilis and HIV serologies; antinuclear, antineutrophil cytoplasmic, and antineuronal nuclear antibodies; erythrocyte sedimentation rate; lead and copper; and cortisol, as well as urine organic acids and lactate (blood and CSF), which did not revealed any abnormalities. CSF showed no abnormalities, except a slight protein elevation. Skin biopsy for granular osmiophilic material (GOM) pathology was absent in regard to Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL). MRI, axial T2-weighted, performed 3.5 years after symptom onset demonstrated localized bilateral frontoparietal periventricular white matter T2 hyperintensities with corresponding atrophy ( ). No final diagnosis was established, but the differential diagnoses included AD, MS and atypical CADASIL, even though skin biopsy was negative for GOM. Autopsy of Case 3 demonstrated white matter pathology; cortical atrophy and axonal spheroids consistent with HDLS ( ). His brother had developed personality, memory and gait problems at age 58 and received the diagnosis of atypical CADASIL, even though he also had a negative skin biopsy test for GOM pathology. His sister developed neurological symptoms at age 18, and became wheelchair bound and bedridden. She died at age 49, diagnosed with MS. Their mother had developed dementia at age 54 and died 7 years after the onset of her symptoms ( ). None of these family members had brain biopsy or autopsy. Case 4. (US family) A 48-year-old male of Polish and German descent experienced gradual progressive gait difficulty affecting the left leg, which gradually affected the right leg. Upon neurological examination six months after onset of symptoms, he was found to be oriented to date, time and place; his MMSE score was 27 of 30 points and he was reported to have a slight personality change, becoming withdrawn and having periods of sadness. He had mild apraxia, masked facies and slow saccadic eye movements (horizontal and vertical) with ocular motor apraxia. There was rigidity and dysdiadochokinesia in all extremities, more on the left side, dysarthria and dysphagia. Over the next six months, his gait became slow and shuffling and he developed neurogenic bladder. Investigational work up was extensive and included; routine complete blood count and chemistry, thyroid function, serum creatine phosphate, ceruloplasmin, lactate, pyruvate, amino acids, cerebrospinal fluid analysis with oligoclonal bands and IgG index, urinary organic acids, angiotensin conversion enzyme, arylsulfatase A, galactocerebrosidase, beta-galactosidase, hexosaminidase, sphingomyelinase, and very long chain fatty acids and all test results were normal. Skin biopsy and NOTCH3 blood test in regard to CADASIL were normal. VDRL, TPHA, Lyme and Brucella screens, HIV and NMO antigene were negative. Paraneoplastic panel, malignancy screening with PET and genetic analyses for Parkin, PINK1, LRRK2; all came out with negative results. EMG, nerve conduction studies and angiogram were both negative. A brain MRI, axial T2-weighted, performed 2.5 years after disease onset showed patchy bilateral frontoparietal white matter T2 hyperintensities extending into the corpus callosum with correspondent atrophy ( ). He received treatment with IV methylprednisolone sodium succinate (1000 mg for three consecutive days every other month for six months), IV plasmapheresis (every 3rd month for 9 months), subcutaneous interferon, 44 μg IFN-1a, (three times weekly for approximately a year) and L-dopa (up to 1000 mg/day over 5 months). These provided no benefit. Over the next three years, his symptoms progressed with increased tone in all extremities, could not ambulate secondary to bradykinesia, prominent bulbar signs with dysarthria and dysphagia and became total care dependent. He is today bedridden and almost mute. Prior to brain biopsy at the age of 50, he received multiple diagnoses including neuromyelitis optica (NMO), AP, atypical MS and progressive supranuclear palsy (PSP) superimposed on MS. His brain biopsy showed white matter abnormalities with axonal spheroids present consistent with HDLS ( ). His half-sister was diagnosed with MS and died, bedridden at age 46. His mother died at the age of 52 in a nursing home after a three-year course of an AP illness1 ( ). Neither individual had a brain biopsy or autopsy. Discussion HDLS is a devastating neurodegenerative disease with adult onset. The disease is inherited in an autosomal dominant fashion, but the genetic defect has not yet been identified. It is thought that HDLS is caused by primary disruption of the axon integrity, neuroaxonal damage, and focal axonal swelling (axonal spheroids) leading to secondary demyelination [10, 11]. However, demyelination may precede the axonal damage [12], triggering an autonomous neurodegenerative process. Neuropathology of our 4 cases demonstrated white matter abnormalities confined to the cerebrum, sparing the optic nerve, and major fiber tracts in the diencephalon, and cerebellum. However, the corticospinal tract, posterior limb of the internal capsule and less affected anterior limb were involved in all cases. Most of the white matter tracts in the brainstem were unaffected, including the medial and lateral lemnisci, medial longitudinal fasciculus and the cerebellar peduncle. The exception was the involvement of the cerebral peduncle and frontopontine fibers in the pontine base. The white matter vacuolation and demyelination with axonal spheroids that are immunoreactive for neurofilament, APP and ubiquitin, the histopathologic hallmark in HDLS, was found in all our cases. Bizarre astrocytes and lipid-and myelin-laden macrophages are also found. There are no pathognomonic lesions that absolutely confirm the diagnosis, but the presence of white matter changes with neuroaxonal spheroids present, confirmed the diagnosis of HDLS in our cases. These findings are similar to those previously reported [1, 3, 10] ( ). In HDLS the basal ganglia, thalamus, hypothalamus, hippocampus, substantia nigra, raphe nucleus, reticular formation and cerebellar grey matter are unaffected. There is no significant evidence of amyloid angiopathy in parenchymal or leptomeningeal vessels. In order to exclude common adult onset leukodystrophies, the Cases 1, 2 and 4 were tested for Arylsulfatase A, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase and very long chain fatty acids. Metachromatic leukodystrophy (MLD), Krabbe disease and X-linked adrenoleukodystrophy (X-ADL) may start in adult age but the neuropathological findings in our cases are incompatible with these diagnoses. In MLD there is accumulation of metachromatic material in the white matter [13]. Krabbe disease is characterized by the presence of globoid cells derived from microglia which have multiple nuclei [14]. X-ALD has often significant inflammatory features in the white matter and lamellar cytoplasmic inclusions in the brain and other organs [15]. These histological features were clearly lacking in the brain in all of our patients, ruling out these diseases on pathologic grounds. Furthermore MLD often has a tigroid pattern of white matter lesion [16] and X-ALD has a predominant parieto-occipital white matter abnormality [17], neither of our cases had a tigroid pattern and all demonstrated frontal predominant white matter lesions. Vanishing white matter (VMW) disease can also present in adult age but it is neuropathologically characterized by increased white matter rarefaction and cystic degeneration, sparse dysmorphic astrocytes, scanty astrogliosis and the distinguishing increased macroglia around cavitated regions and in lesser affected areas. It has characteristic foamy oligodendrocytosis and apoptotic loss of oligodendrocytes [18]. These features were not present in our cases. The rarer adult onset lysosomal storage diseases such as adult (Type 3) GM1 Gangliosidosis [19], Niemann –Pick (GM2 and GM 3 gangliosides) [20]; Fabrys disease [21] and the even more rare hexosaminidase A deficiency [22, 23] differ from HDLS both in clinical- and MRI presentations and neuropathologically. White matter lesion with axonal spheroids can also be due to Nasu-Hakula disease or traumatic closed head injury [24, 25]. Naso-Hakula disease can present with a clinical syndrome similar to HDLS, but contrarily, affected patients complain of pain and tenderness of ankles/feet/wrist, and there are characteristic cystic bone lesions seen on plain radiological films [26]. There was no history of head trauma in any of our cases. Adult onset autosomal dominant leukodystrophy (ADLD) often initially presents with autonomic symptoms followed by cerebellar and pyramidal signs. It has a characteristic MRI pattern and neuropathology with loss of myelin and rarefaction with vacuolated myelin in both the white matter of cerebrum and cerebellum; atrophy and signal changes in medulla oblongata and spinal cord; and normally usually no axonal spheroids, differentiating it from HDLS [27, 28]. All of our cases were post-mortem and were tested genetically for Naso-Hakula and ADLD with negative results. Skin biopsies were obtained and the skin vessels were tested for accumulation of GOM by electron microscopy in all of our cases, but the NOTCH3 gene mutations were not performed in Case 3. GOM has been considered specifically diagnostic for CADASIL, but the reports on the sensitivity of detecting GOM in patients' skin biopsy have been contradictory. However, there was no characteristic white matter lesions in the temporal poles on MRI [24] and the neuropathology was incompatible with CADASIL; having no evidence for infarct or arteriolar pathology to support a vascular etiology [29]. The clinical characteristics of Case 1–4 are summarized in . The three unrelated families illustrate the clinical and neuroimaging similarities of HDLS. In these Cases, the disease commenced with changes in personality, memory and executive functions, depression and/or parkinsonism, and later progressed to devastation across multiple domains of neurological impairments. There are several novel factors in relation to our cases. The first matter is that all cases we have identified so far are Caucasians. This may represent a possible risk allele in Caucasians. However, an ascertainment bias can not be excluded and more research is needed to confirm this observation. Secondly, we report the families from Norway and Germany. To our knowledge this is the first report of a Norwegian family with HDLS and first report of a familiar case with HDLS from Germany. However, Mayer et al. [8] have reported two German independent cases with sporadic leukoencephalopathy with axonal spheroids. Thirdly, our Case 3 had also a palatal tremor. Palatal tremor has not been reported in HDLS cases. Therefore, this observation expands the phenotypic presentation of HDLS. Finally, all of our cases have been neuropathological evaluated by the same pathologist confirming the diagnoses of HDLS. This is an important factor in studying rare neurodegenerative disorders. The mean age of onset in our patients was 44 years (range, 36–52 years), disease duration was six years (range, 3–11 years) and the mean age of death was 48 years (range, 40–63 years). All patients had bilateral frontal and parietal white matter T2 hyperintense foci with frontal prominence; the foci often extended from the periventricular and deep regions to the subcortical tissues. Atrophy was associated with the regions of signal abnormality. All the cases demonstrated abnormal T2 signal in the corpus callosum with or without atrophy (Case 2 not shown). Cases 3 and 4 demonstrated a convincing family history, whereas it remains unclear whether the Norwegian family reflects reduced penetrance or a de novo mutation. Leukoencephalopathies with adult onset are serious disorders and the combination of extensive white matter lesions in cases with progressive neuropsychiatric symptoms constitutes a common diagnostic dilemma. Many of these disorders, even a few hereditary disorders, are treatable, so it is of utmost importance to clarify the diagnostic spectrum. Better understanding of leukoencephalopathies in neurological practice is crucial to differentiating among metabolic, toxic, inflammatory, vascular white matter diseases or heritable illness. Clinical differential diagnoses include dementia (e.g., FTD and AD) [30, 31]; atypical Parkinsonism (e.g., corticobasal degeneration, multisystem atrophy or PSP) [32]; progressive MS [33]; and leukodystrophies [34]. On MRI, HDLS could be mistaken for other leukoencephalopathies, usually early in the disease stage, like Nasu-Hakola disease, VWM, X-ALD, MLD, Krabbe disease and even a Susac's syndrome [34, 35]. In addition, a family history consistent with a dominant autosomal disease could suggest adult onset Alexander disease, ADLD and CADASIL [24, 28]. However, diagnostic MRI criteria may predict these latter diseases with high probability and most of the ones listed also have a known gene mutation [34, 36]. We conclude that HDLS imitates many neurodegenerative diseases. An accurate diagnosis of HDLS currently depends on a histopathologic evaluation, because the gene(s) causing HDLS remain unknown. Finding the gene for this condition is of paramount importance in understanding the neurodegeneration associated with white matter abnormalities. The identification of three new families with pathologically-confirmed HDLS in this study further suggest that HDLS may be frequently unrecognized and misdiagnosed. Alerting the clinicians to this disorder will feasibly increase identification of HDLS cases. Being familiar with the clinical presentation and neuroimaging will aid in the diagnostic evaluation.
1850
dbpedia
1
15
https://elifesciences.org/reviewed-preprints/96693
en
Modeling Hereditary Diffuse Leukoencephalopathy with Axonal Spheroids using microglia-sufficient brain organoids
https://prod--epp.elifes…ax/0/default.jpg
[ "https://elifesciences.org/reviewed-preprints/_next/static/media/elife-logo.2ab2ee88.svg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig1.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig2.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig3.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig4.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig5.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig6.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_utbl1.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_utbl2.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_figs1.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_figs2.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_figs3.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls1.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls2.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls3.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls3a.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls3b.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls4.tif/full/max/0/default.jpg", "https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls5.tif/full/max/0/default.jpg", "https://elifesciences.org/reviewed-preprints/_next/static/media/hhmi.9d544219.svg", "https://elifesciences.org/reviewed-preprints/_next/static/media/wellcome.6030b788.svg", "https://elifesciences.org/reviewed-preprints/_next/static/media/max.7d8ce9e5.svg", "https://elifesciences.org/reviewed-preprints/_next/static/media/kaw.ee7653b1.svg", "https://elifesciences.org/reviewed-preprints/_next/static/media/carbon-neutral.1d34f2f1.svg" ]
[]
[]
[ "" ]
null
[ "Wei Jie Wong", "Yi Wen Zhu", "Hai Ting Wang", "Jia Wen Qian", "Ziyi Li", "Song Li", "Zhao Yuan Liu", "Wei Guo", "Shuang Yan Zhang", "Bing Su" ]
2024-06-13T00:00:00+00:00
en
null
Introduction Hereditary diffused leukoencephalopathy with axonal spheroids (HDLS) – also known as adult-onset leukodystrophy with axonal spheroids and pigmented glia (ALSP), is a rare, inherited, autosomal dominant, neurodegenerative disease that is characterized by patchy axonal swellings (spheroids) and demyelination that result in the alteration of the white matter of the brain (1). Although detailed epidemiological data are lacking, in 2021, it was estimated that approximately a quarter of a million people globally are affected by the condition (2); yet our understanding of the pathogenesis of the disease is limited, and there is no cure or even effective treatment. For more than a decade, we have known that HDLS is caused by mutations affecting the colony-stimulating factor-1 receptor (CSF-1R) (3) which most often occur in the tyrosine kinase domain (TKD) (4), and lead to reduced auto-phosphorylation in response to CSF-1, which results in impaired downstream signaling (4, 5). These mutations most profoundly affect microglia (6), the specialized brain-resident macrophages that play critical roles in brain development and homeostasis (7, 8) as well as in a wide range of neuroinflammatory and neurodegenerative diseases (9). Patients with HDLS have few, small, microglia that are distributed abnormally within the neocortex and that express low levels of the homeostatic marker P2RY12 and high levels of the inflammatory marker CD68, compared to healthy controls (10–12). Studies aiming to understand the pathophysiology of HDLS have used various approaches. Rodent models have been generated, but do not faithfully recapitulate the disease phenotype in humans: the earliest haplo-insufficient Csf-1r+/- mice model exhibited microgliosis within brain regions (13), but this was not recapitulated in a later Csf-1r knockout rat model (14); while a subsequent orthologous mouse model has phenocopied the reduced microglia density seen in patients with HDLS but does not exhibit brain pathology (15). A zebrafish model of HDLS similarly saw reduced microglia during brain development (16), but does not offer the opportunity to study pathology associated with adult-onset neurodegenerative diseases (17). To overcome these species-specific limitations, in this study we generated human induced pluripotent stem cell (iPSC) - derived macrophages from patients with HDLS and used them to create microglia-sufficient autologous brain organoids (18) in which we characterized the effects of naturally occurring CSF-1R mutation on microglial function. By comparing iPSC-derived macrophages to genetically corrected macrophages from the same patients, we uncovered evidence of significant transcriptional and metabolic reprogramming that was associated with profound changes to neuronal regulation by these cells, indicative of the likely mechanistic links between microglial dysfunction and HDLS. Results Generation and characterization of iPSC lines from patients with HDLS We first isolated dermal fibroblasts from skin biopsies taken from two patients with HDLS and confirmed mutations in the TDK region of the CSF-1R gene (HD1, HD2; clinical characteristics shown in Supplemental Table 1) then cultured them for approximately four weeks before reprogramming into induced pluripotent stem cells (iPSCs) (Fig 1A). Four to five weeks post-transfection, we observed iPSC-like colonies emerging (Supp Fig 1B), and 7-10 days later, we selected those clones that were proliferating and displayed typical iPSC morphology (Fig 1C). We confirmed successful reprogramming by visualization of pluripotency markers including SOX2 and OCT4 (nuclear markers), and TRA-1-60 and SSEA-4 (intracellular marker), by immunofluorescence (Fig 1D). We also confirmed that these clones had normal karyotype (Fig 1E) and termed them Mut HD1 and Mut HD2. One clone per cell line was used for further analysis. We then generated isogenic from Mut HD1 and Mut HD2 iPSC cell lines which we termed IsoHD1 and IsoHD2 respectively, as controls (see Methods). Clones that were karyotypically normal were used for downstream experiments alongside their mutant counterparts (Fig 1B), with no off-target events identified (Supp Fig 1C). Collectively, HDLS iPSC and their corresponding isogenic iPSC controls were successfully generated from two patients with HDLS (HD1 and HD2). Generation and characterization of patient iPSC-derived macrophages We next sought to differentiate primitive microglia-like macrophages from patient-derived iPSC cell lines (iMacs) using our serum-free protocol that faithfully recapitulates the generation of in vivo microglial progenitor cells (19). Briefly, iPSCs were initially inducted towards the mesodermal lineage before being differentiated into hemangioblast-like cells with the potential to differentiate into both endothelial and hematopoietic progenitors - the latter emerging as free-floating cells as early as day six after seeding - which we collected and then terminally differentiated into iMacs by the addition of CSF-1 (Fig 2A). Although HDLS mutation downregulates the sensitivity of CSF-1R to its ligand (5), we were able to successfully generate iMacs using this protocol: the yield of iMacs from iPSC varied between cultures (Fig 2B), but flow cytometry confirmed their consistent macrophage-like phenotype, with abundant expression of CD45 and CD14 (Fig 2C), and Giemsa staining showed that iMacs exhibited comparable morphology between donors (Fig 2D). Functionally, all iMac cultures were equally able to take up PE-labelled beads that were detectable within their cell bodies (Fig 2D); flow cytometry confirmed that the level of actin-dependent phagocytosis of pHrodo beads was comparable among CD45-expressing cells from all cultures (Fig 2E). Collectively, these data show that iMacs generated from HDLS donor-derived iPSC adopted the typical morphology, phenotype and functions associated with macrophages. The mutations associated with HDLS downregulate the sensitivity of CSF-1R to its ligand CSF-1, but to different extents depending on the mutation site (5). We therefore compared the survival of our mutant and isogenic cells lines from both patients during culture with CSF-1. As expected, even with high concentrations of CSF-1, relatively few mutant cells survived across seven days of culture; by contrast, even low CSF-1 levels allowed significantly more isogenic cells to survive (Fig 2F). In summary, we generated iMacs from iPSC of patients with HDLS and their respective isogenic controls that exhibit typical macrophage morphology, phenotype, and phagocytic capabilities. Mutant and isogenic control iMacs have distinct gene expression profiles Although iMacs derived from patients with HDLS exhibited core macrophage features, we wanted to more fully understand the impact of CSF-1R mutation on these cells. We first characterized their gene expression profile using bulk RNA-seq and compared it to that of their respective CSF-1R-restored isogenic iMac cultures. Principal component analysis (PCA) showed that patterns of gene expression differed markedly between mutant and isogenic iMacs. Among cell cultures from HD1, mutant iMacs exhibited patterns of gene expression consistent with a more reactive state compared to isogenic CSF-1R-restored HD1: HD1 Mut had higher expression of genes involved in pathways related to proliferation (IGF2, MYBL2, STAT1, INCEP, TGFA) and the defense response to virus (IFI27, IFI44L, STAT1, MX1, IFIT3); while Iso HD1 iMacs expressed high levels of genes involved in chemokine-related responses and signaling pathways (CXCL2, ADAM8, CCL31L, CCL5,), as well as leukocyte migration and chemotaxis (CXCL3, CCL13, CCL2, E5AR1, C3AR1) (Fig 3A-C). We observed a similar transcriptomic profile in HD2-derived iMacs: HD2 Mut showed up-regulated gene expression for the defensive response to virus, while isogenic HD2 iMacs exhibited high expression levels of genes involved in leukocyte migration and chemotaxis (Fig 3D-F). These data are in line with previous reports suggesting that macrophages from patients with HDLS adopt an inflammatory phenotype with increased expression of the immunoreactive markers CD68 and CD163 (10, 12). Additionally, an upregulation of the immature myeloid cell marker MPO (20), and a reduced expression of mature macrophage marker MARCO (21) was observed within mutant iMac of both cell lines. Taken together, iMac cultures derived from patients with HDLS exhibited transcriptomic profiles consistent with upregulated inflammatory gene expression as a result of impeded CSF-1R function. Mutant and isogenic control iMacs have distinct metabolic profiles Studies have shown that activated macrophages often undergo metabolic reprogramming to fulfil the energetic needs of demanding biochemical processes (22, 23); alongside, we know that energy metabolism, as well as metabolic cell features, plays an important role in mediating macrophage function and plasticity (24). Therefore, we next compared the cellular metabolic profiles of patient-derived CSF-1R mutant and isogenic CSF-1R-restored iMacs. We first assessed glycolysis by measuring the extracellular acidification rate (ECAR) in the presence of specific modulators (glucose, oligomycin, 2-deoxy-glucose) that were added sequentially to the cell cultures to reveal various aspects of the metabolic pathway (see Methods): this showed that CSF-1R-mutant iMacs from both HD1 and HD2 had a significant overall increase in glycolytic function (Fig 3G and 3O). Although the magnitude of the difference between iMac HD1 and HD2 and their respective CSF-1R-restored counterparts varied, in both cases, CSF-1R mutation was associated with significantly increased glycolytic capacity and glycolytic reserve. Next, we determined the functional metabolic profile of mitochondrial respiration by measuring real-time changes in the extracellular oxygen consumption rate (OCR) during sequential treatment of cells with oligomycin, carbonyl cynide p-trifluoromethoxyphenylhydrazone (FCCP) and a combination of rotenone and antimycin A. As before, although the magnitude of effect was less for cells from HD1, both sets of iMacs showed a similar trend towards higher OCR values, and greater capacity for basal respiration, ATP production, and maximal respiratory capacity in the presence of mutated CSF-1R in the case of HD2 Mut cells, these differences achieved statistical significance across all three bioenergetic parameters. Taken together, these results indicate that the absence of fully functional CSF-1R in cells from HD1 and HD2 is associated with an upregulated glycolytic metabolic profile, which is cells from HD2 is clearly accompanied by a higher mitochondrial oxidative phosphorylation rate. This suggests that macrophages from patients with HDLS have an altered metabolic profile that correlates with their higher activation status and could contribute to disease pathology. HDLS iMacs upregulate IL-1β when exposed to apoptotic neuronal cells Our data suggest that mutant iMacs have dysregulated transcriptomic and metabolic profiles, suggestive of an active inflammatory state. To better understand how this would be expressed in the context of their functions in the brain, we mimicked a need for apoptotic cell clearance by incubating iMacs from patients with HDLS with UV-irradiated neuronal SH-SY5Y cells (Supp Fig 2A). Both iMac lines (CSF-1R mutant and isogenic) from both patients effectively phagocytosed apoptotic but not control, non-UV-irradiated, SH-SY5Y cells, in an actin-dependent manner (Supp Fig 2B). We then measured the expression of genes encoding pro-(IFN-g, TNF-α, IL-1β, IL-6, IL-18) and anti-(IL-10, IL-12, TGF-β) inflammatory cytokines following incubation of iMacs with UV-irradiated or non-irradiated SH-SY5Y cells, or without any SH-SY5Y cells, for eight hours. We observed a significant and specific increase in IL-1β transcription in CSF-1R mutated iMacs from both HD1 and HD2 when exposed to apoptotic cells, compared with their isogenic counterparts. Among the anti-inflammatory cytokines, Mut HD2 cells exhibited significantly increased transcription of the gene encoding TGF-β when cocultured with UV-treated cells, alongside high baseline levels of IL-12 and TGF-β in control cultures compared to isogenic HD2 iMacs. Interestingly, all CSF-1R mutant iMac groups had higher levels of transcription of most pro-inflammatory cytokines at baseline, consistent with their activated/reactive transcriptional profile, than did their CSF-1R-restored counterparts (Fig 4A-B). Collectively, all iMacs exhibited the ability to specifically phagocytose apoptotic cells, but in the absence of a fully functional CSF-1R, this led to high levels of IL-1β transcription, which reflected a general propensity towards the transcription of pro-inflammatory cytokine genes, even in the absence of overt stimulation. Importantly, restoration of CSF-1R via gene editing was sufficient to reverse this inflammatory phenotype. iMacs differentiate into microglia-like cells (iMicro) in a coculture with forebrain organoid During HDLS, patients typically exhibit degeneration of the frontal lobes of the brain, which contributes to the deficit and decline in cognitive ability, changes to personality and behavior, and dysfunctional motor, social, and language skills (25, 26). Therefore, we next generated iPSC-derived forebrain organoids including autologous iMacs from patients with HDLS to better understand their potential role in the brain. To better understand how diseased or non-diseased macrophages affect the developing brain, we first generated forebrain organoids from the isogenic cell line variant of the respective donor’s iPSC (see Methods). After 31 days, organoids were harvested (Supp Fig 3A) and co-cultured for seven days with isogenic or mutant iMacs that had been generated in parallel (Fig 5A). At this point, each organoid was removed from its coculture and cultured individually for 16 more days (Fig 5B). We then applied 3D imaging of forebrain organoids to assess their morphology and the distribution/differentiation of the iMacs. This showed that iMacs expressing the microglial marker IBA-1, were mostly located on the surface of the organoids (Fig 5C). We also labelled organoids for NESTIN (a neuronal cell marker) and SOX2 (expressed by neuronal progenitor cells (NPCs). In all of the organoids, neural epithelial rosettes were present, consisting mostly of SOX2+ NPCs (Supp Fig 3B); these structures indicate favorable organoid growth as they demonstrate proper lineage progression leading to forebrain region identity (27) Importantly, organoids to which we did not add iMacs did not contain any IBA-1+ cells (Supp Fig 3C); this was as expected from our previous work (18), but was in contrast to previous studies that reported innately-derived microglia in mesodermal-lineage-containing cerebral organoids (27, 28). Next, we characterized the different cell populations within organoids after 23 days of coculture and compared iMacs before and after co-culture. After organoid dissociation, cells were labelled with antibodies to differentiate neurons (CD45-/CD184-/CD44-/CD15lo/CD24+), NPCs (CD45-/CD184+/CD271-/CD44-/CD24+) and iMacs (CD45+) before undergoing sorting (Fig 5D) followed by bulk-RNA sequencing. During the course of the work, sufficient iMicro numbers for downstream analysis were only generated from coculture with mutant iMacs for HD1 and isogenic iMacs for HD2 respectively. Compared to Day 31 non-co-cultured iMacs, HD1 iMacs after co-culture had profoundly altered their gene expression (Fig 5E), with the upregulated DEGs showing an increase in various pathways that are characteristic of microglial functions in the brain such as central nervous system and brain development (CNTN1, ZIC2, EFNA2, GLI3), synapse organization, synapse and neuron organization and development (SLC1A1, DGKB, TRIM67), as well as neurogenesis (CHD11, ADCYAP1) (Fig 5F-G). Likewise, for HD2 iMacs, PCA also suggested that their patterns of gene expression were markedly different between cocultured and non-cocultured populations (Fig 5H), while GO analysis of the upregulated DEGs revealed an increase in various pathways linked with typical microglial functions in the brain such as glial cell differentiation and gliogenesis (CLU, MDK, CXCR4, RELN, TMEM98, TUBA1A), axonal development (UCHL1, MAP1B, CRABP2, TUBB2B, LGI1) as well as forebrain development (TUBB2B, MDK, CXCR4, RELN, LHX2) (Fig 5I-J). This shows that iMacs undergoing coculture with forebrain organoids have differentiated to a certain extent, into microglia-like cells. Co-culture results in impaired regulation of neurons within organoids Microglia not only act as sentinel cells, but are also important contributors to neuroplasticity and neurogenesis in the developing brain that ultimately help shape the brain circuitry (29). Part of this role requires microglia to regulate the population of NPCs and neurons during the unrestrained, highly proliferative phase of early brain development (30, 31); therefore, we next asked whether the microglia-like cells from our iMac-forebrain organoids were also capable of regulating neurogenesis in vitro. As such, we sought to compare the size of the organoids, as well as the individual major cell population in each organoid, for both variants between isogenic organoids that did not undergo co-culture, and those that underwent 23 days of co-culture by comparing their area before and after co-culture. Co-culture of HD1 saw a slight reduction in the organoid size among both co-culture parameters before and after co-culture. However, comparison of the organoid size on coculture Day 23 only, saw the isogenic control parameter as the only group that had a reduction in organoid size when compared to the organoid-only control (Fig 6A). On the contrary, HD2 displayed no significance in organoid size reduction even after co-culture (Fig 6B). Subsequently, these co-cultured organoids were dissociated, stained, sorted and quantified for the respective cell populations. Co-culture of IsoHD1 organoid with IsoHD1 iMac saw a significant reduction in the neuronal population when compared to control organoids that did not underwent co-culture. Conversely, coculture with mutant HD1 iMac saw a smaller degree of neurons reduction but was not significant (Fig 6C). Next, co-culture of IsoHD2 organoid with IsoHD2 iMac saw a slight reduction in neuronal population that was not statistically significant, while the co-culture with mutant HD2 iMac saw no difference when compared with control organoids (Fig 6D). Interestingly, we did not detect any change in the NPC population for either HD1 or HD2 after co-culture, likely because their numbers were relatively low to begin with due to the cellular composition of the forebrain organoid. Similarly, the iMac population was also small in all co-cultures. Transcriptomic analysis of the neurons of HD2 co-culture saw the mutant iMac co-culture having upregulated expression of genes associated with mitochondrial respiration (BCS1L, MRPL18, TSFM, MRPL11, MRPS30) but this phenomenon was not present in the isogenic iMac co-culture (Fig 6E). Conversely, transcriptomic analysis of the NPCs of HD2 co-culture saw the isogenic iMac co-culture having upregulated expression of genes associated with mitochondrial respiration (Fig 6F). Taken together, our model suggests that HDLS mutation affects neuronal population in a microglia-dependent manner and that this phenomenon is variable and mutation-dependent. Discussion HDLS is an incurable neurodegenerative disease that begins in adulthood, progresses rapidly and has a grim prognosis. Efforts to elucidate the functional or dysfunctional aspects of the causative mutations in the CSF-1R gene have been hampered by the lack of an accurate disease model that recapitulates the human pathology: although rodent and zebrafish models have been generated and imparted valuable insights towards HDLS (13–16), discrepancies and limitations in each case have led to incomplete recapitulation of the disease’s pathology, specifically in microglia numbers within brain regions and the effects on respective cognitive and sensorimotor tests. Additionally, a model looking into immune-neuronal crosstalk to better understand a neurodegenerative disorder that is primarily associated with microgliopathy, is important to advance the field. Here, we first generated iPSC lines from two patients with HDLS and then used CRISPR/Cas9 technology to reinstate a fully functional CSF-1R gene into some of the lines. While the generation of an HDLS donor-derived iPSC cell line has been reported (32), no other in vitro studies have yet reverted the causative mutation to wild type; a necessary step to understanding the direct impacts of diminished/absent CSF-1R signaling. We then generated and characterized iMacs - precursors of microglia - from these lines, which exhibited typical morphology, phenotype and phagocytic capacity that were not obviously affected by CSF-1R mutation. Although we were able to generate phenotypically and functionally similar iMac across these lines for example for phagocytic capability, iMac yield varied greatly between the cell lines with a 50% lower yield for Mut HD1 compared to IsoHD1 and, conversely, a higher yield for Mut HD2 200% compared to IsoHD2. This fundamental difference could be attributed to their respective mutations: the nonsense mutation identified in HD2 could not only more profoundly affect receptor signaling, but might also be a major factor during the course of gene editing leading to incomplete reversion to wild type at the epigenetic level, which we speculate was not the case for IsoHD1. Additionally, this observation could also be attributable to a reduced CSF-1 sensitivity in HD2 Mut iMacs as compared to HD1 Mut iMacs and we speculate that this would potentially give rise to the generation and subsequent maintenance of immature iMacs that lacks maturation even after terminally differentiated into tissue-resident macrophages. Functionally, while phagocytosis of E.Coli beads was similar across lines, the baseline cytokine production as well as after phagocytosis of apoptotic neuronal cell line was different with an increase of IL-1β secretion in both mutant HD1 and HD2, compared to isogenic HD1 and HD2 iMacs. In the case of phagocytosis of apoptotic cells, this was not due to a difference in phagocytic activity as all cells were able to phagocytose apoptotic cells at a similar level. Importantly, higher levels of baseline pro-and anti-inflammatory cytokine production in the control group without apoptotic cells were observed within HD1 mutant, and both HD1 and HD2 mutant iMacs respectively. This suggest that mutant iMacs are innately in a more reactive or activated state when compared to isogenic iMacs and could reflect the reactive phenotype of HDLS-associated microglia and macrophage identified in vivo (10, 12). Conversely, isogenic iMacs seems to adopt less of the reactive phenotype with the reverted mutation as identified with an overall lesser cytokine production level. Importantly, such reactive phenotype was also highlighted by our transcriptomic and metabolic profiling with upregulated pathways involving pro-inflammatory cytokines and preferential utilization of the glycolytic pathways in the mutant groups, a feature of macrophage activation (33, 34), respectively. We subsequently incorporated donor-specific and their isogenic controls into a co-culture system using 3D forebrain organoids and iPSC-derived macrophages to better study HDLS. Isogenic and mutant iMacs co-cultured separately with their respective isogenic forebrain organoid differentiate into microglia-like cells with 23 days of coculture as shown by the expression of the microglial marker IBA-1, their ramified morphology as well as their transcriptomic profiles with up-regulation of genes associated with biological pathways that are typical of microglia functions such as neurodevelopment, neurodifferentiation, neurogenesis and brain development. Subsequently, we analyzed the size of the organoids before and after co-culture as we recently showed that addition of iMac modulated NPC differentiation, limiting their proliferation and promoting axonogenesis, resulting in a reduction of co-culture organoid size (18). Here, while we noticed a significant decreased in the size of isogenic HD1 forebrains co-cultured with isogenic HD1 iMac compared to isogenic HD1 organoids, we did not measure any significant change in organoid size in the isogenic HD1 organoids co-cultured with mutant HD1 iMacs. This suggested that the crosstalk between iMicro and NPC is dysregulated in the context of the HD1 mutation. Since we showed that such size reduction is mediated by cholesterol transfer from iMicro to NPC, further work will be required to characterize cholesterol metabolism of HD iMac. While we did not observe major changes in cell type composition in these cocultures, transcriptomic analysis of neuronal and NPC population after co-culture showed an increase in mitochondrial respiratory pathways associated genes in the mutant HD2 iMac co-culture neuron and isogenic HD2 iMac co-culture NPCs population respectively. This suggests increased metabolic rates in these respective populations that are contributed to by the different variants of iMac during co-culture, and show that mutated iMicro can change the states of non-mutated isogenic organoid cells. A parallel process in vivo would likely have profound long-term consequences for brain development and homeostasis. Altogether, we propose that CSF-1R mutation in HDLS may cause subtle yet impactful disruptions to microglia homeostasis due to abnormal metabolic functions in the developing fetal brain, that subsequently compound and result in aberrant microglia functions during adulthood. This could also be mediated by upregulated pro-inflammatory cytokine production such as IL-1β at a basal level or upon clearing of cellular debris during development and adulthood homeostasis. IL-1β is of particular interest as numerous studies reported the role of IL-1β in neuroinflammation and neurodegeneration especially within the field of Alzheimer’s disease: for example, postmortem brain sample analysis revealed elevated levels of Il-1β production, including around amyloid beta plaques; all suggestive of pathology-associated inflammation (35–37). Hence, we speculate that in CSF-1R+/- mutant microglia, which already have a predisposition towards increased secretion of IL-1β, are constantly being activated by IL-1β, either autocrine or paracrine, creating a dysfunctional neuro-environment that contributes to HDLS pathology. As such, experimental models looking to block or reduce IL-1β levels in the brain using the human mAb, canakinumab, targeting the proinflammatory cytokine IL-1β (38, 39), during both health and disease could be a potential target for therapy and may help to ameliorate HDLS pathology. While no model perfectly recapitulates the full complexity of a disease, the application of iPSC-derived organoid co-culture approaches to primary patient-derived cells offers a valuable way to study the disease mechanisms of this rare pathology using human cells. Future studies employing microglia-sufficient patient-derived brain organoids have the potential to shed much-needed light into the pathogenesis of HDLS and other neurodegenerative diseases. Materials and methods Preparation of human dermal fibroblasts from donor biopsies Samples from patients with HDLS were collected via skin punch and placed in biopsy medium [Gibco DMEM Glutamax supplemented with 1% 100x Antibiotics/Antimycotics (Gibco AB/AM) and 10% Fetal Bovine Serum (Gibco, FBS)] for transport to the laboratory. Immediately on arrival, biopsies were placed in 75% ethanol for 30 sec then washed three times with DMEM Glutamax supplemented with 1% AB/AM; attached adipose tissue was removed using sterile scissors before biopsies were cut into small 1mm2 cubes and placed dermis-side down onto a 6-well plate then left to dry slightly for 20 min to facilitate adhesion. Biopsy culture medium was then added and plates incubated overnight at 37°C, 5% carbon dioxide in air; 48 hrs later, the medium was changed then biopsies cultured for a further 10-14 days during which fibroblast outgrowth was observed. At around 90% confluency, fibroblasts were detached from the plates using 0.05% Trypsin/EDTA and passaged. Biopsies were re-plated up to three times for further fibroblast propagation. Reprogramming of human dermal fibroblasts into induced pluripotent stem cells Individual donor’s fibroblasts were reprogrammed into induced pluripotent stem cells (iPSC) using the Epi5 Episomal reprogramming kit (Invitrogen), and the Human dermal fibroblast nucleofector kit (Lonza) on a Lonza Nucleofector 2B device. Briefly, fibroblast cultures at approximately 90% confluency were detached from their plates using 0.025% Trypsin/EDTA then collected by centrifugation at 350 g for 5 min at room temperature. Cell pellets were resuspended in 100 µl of nucleofector solution at room temperature then counted: 200,000 cells were used per transfection with 1 µl of each of the episomal vectors, using program U-023. Transfected cells were subsequently plated onto Matrigel-coated (Stemcell) 6-well plates with 2 ml of pre-warmed fibroblast medium (DMEM supplemented with 10% FBS & 1% AB/AM) and incubated for two days. The medium was then replaced with 2 ml of TeSR-E7 medium, which was changed every two days for 25-35 days until early iPSC clones emerged. Isolating iPSC colonies Between days 25 and 35, colonies resembling human embryonic stem cell colonies emerged, were collected using a sterile needle under a stereomicroscope, mechanically fragmented, and added to 24-well plates pre-coated with Matrigel and containing 500 µl of mTeSR-1. The colonies were cultured for 24 hr then underwent medium change with fresh mTeSR-1 for 7-10 days until 80% confluent. Culture and maintenance of iPSC cell lines To passage, 500 ul of ReleSR were added into each well and incubated in 37°C for 3 min before tapping the plate firmly on all sides to dislodge the iPSC colonies. Subsequently, the iPSC fragments were transferred into 12-well plates and again cultured until approximately 80% confluent, before passaging into 6-well plates, all while maintaining in mTeSR-1 with daily medium change. Mature iPSC colonies were identified by their characteristic phenotype: clear distinct borders, high nuclei-to-cytoplasm ratio, and raised, refractive, three-dimensional-like colonies. Characterization of induced pluripotent stem cell colonies Characterization of iPSC colonies was achieved using the PSC 4-Marker Immunocytochemistry Kit (Gibco). Briefly, spent mTeSR-1 medium was aspirated from the cells before adding 200 µl of fixative solution per well and incubating for 15 min at room temperature, which was then replaced by 200 µl of permeabilization solution for 15 min, then by 200 µl of blocking solution for 30 min. Subsequently, 2 µl of antibodies recognizing SSEA4 and OCT4 were added directly to the blocking solution and incubated for three hrs before washing three times with wash buffer (1x DPBS). Secondary antibodies were added at 0.8 µl per well and incubated for one hr at room temperature before washing three more times. During the last wash, one drop of NucBlue Fixed Cell Stain (DAPI) was added into the wash buffer and incubated for 5 min. Cells were either imaged immediately or stored at 4°C in the dark, for up to one month before analysis. Karyotyping iPSC colonies Mature iPSC colonies were pre-treated with 0.1 µg/ml of colcemid for 3 hr in the incubator before dissociation into single cells for imaging. Subsequently, cells were fixed with 4% PFA and sent for karyotype analysis at Zhen He Biotech, Shanghai. Microscopy Cell morphology observations were regularly performed using an Olympus CKX41 inverted microscope. Bright field and phase contrast images were taken using a Nikon Eclipse TS2 inverted microscope equipped with a Digital Sight camera. Images were processed using the proprietary software ImageView. Differentiation of iPSC into primitive-like macrophages (iMacs) Patient-derived iMacs were generated as previously described (1). Briefly, iPSCs were cultured in Stempro34 medium, supplemented with L-glutamine (100x) , ascorbic acid (5mg/ml), 1-Thioglycerol (26ul/2ml), Transferrin (200x) and Pen/Strep (1%), with the addition of CHIR99021 (2 µM), VEGF (50 ng/mL) and BMP4 (5 ng/mL) from days 0-2 to induce mesodermal lineage commitment; hemangioblast-like cell formation was then induced by culture in the presence of BMP4 (5 ng/mL), VEGF (50 ng/mL) and bFGF (20 ng/mL) on day 2 and only VEGF (15 ng/mL) and bFGF (5 ng/mL) on day four. From day 6-10, hemangioblasts were further committed to the generation of hematopoietic cells by the addition of DKK-1 (30 ng/mL), VEGF (10 ng/mL), bFGF (10 ng/mL), IL-6 (10 ng/mL), IL-3 (20 ng/mL) and SCF (50 ng/mL). To further promote the maturation of hematopoietic cells and CSF-1R expression, on days 12 and 14, medium was supplemented with SCF (50 ng/ml), bFGF (10 ng/ml), IL-6 (10 ng/ml) and IL-3 (20 ng/ml). From day 16 to day 31, the medium was switched to SF-Diff consisting of IMDM (75%) and F12 (25%) with the addition of N2 (100x), B27 (50x), 0.05% BSA, 1% Pen/Strep, supplemented with 50 ng/ml of CSF-1 to terminally differentiate the primitive cells to iMacs. Full medium changes were carried out every two days from days 0-14 and every three days from days 16-31. Free-floating cells were observed from as early as day six of culture and were collected and re-seeded back into individual wells during medium changes. Additionally, iMacs were initially cultured in a hypoxia incubator (5% O2, 5% CO2) from day 0–8 before moving into a normoxic incubator until day 31, when the cells were used for experiments. iMac identity was confirmed by flow cytometry with labeling for the macrophage markers CD45 and CD14. Generation of forebrain organoids Forebrain organoid generation was adapted from Qian et al., (2), which described a guided differentiation method that requires various cytokines and growth factors to be added at different differentiation stages, as follows. Stage 1 (days 0-4: embryoid body formation) iPSC on 6-well plate at approximately 80% confluency were dissociated into single cells using Accutase (Stemcell) before counting and seeding at 50,000 cells per well into an ultra-low attachment (ULA) 96-well plate with 150 µl of forebrain first medium (F1M: DMEM/F12, 20% KOSR, 1x GlutaMax, 1x MEM-NEAA, 1x 2-Mercaptoethanol, Pen/strep, Dorsomorphine 2 µM, A-83 2 µM) and 20 µM of ROCK Inhibitor (Stemcell). Plates were incubated at 37°C and 5% CO2 for 24 hrs (day -1). On day zero, medium was refreshed with the addition of 2 uM Dorsomorphin (Sigma) and 2 uM A83-01 (Sigma). Half medium changes were then performed on days two and four with the exclusion of ROCK inhibitor: small embryoid bodies (EB) were observed at this point. Stage 2 (days 5–13: neuro-ectodermal induction) On day five, one EB was transferred into each well of a ULA 24-well plate with 500 µl of Forebrain second medium (F2M: DMEM/F12, 1x N2 supplement, 1x GlutaMax, 1x MEM-NEAA, Pen/Strep, CHIR-99021 1 µM, SB-431542 1 µM). On day seven, healthy EB displaying a smooth and round surface were embedded individually into 20 µl of Matrigel, according to the method of Lancaster et al., (3). Once the Matrigel had fully polymerized, eight embedded EBs were transferred into a 10 cm petri dish with 10 ml of F2M before incubating at 37°C with half medium changes every two days until day 13. At this point, cluster(s) of neuroepithelium buds were present in individual organoids, evident as neural tube-like structure without extending cell processes. Stage 3 (days 14–31: maturation) On day 14, Matrigel-embedded organoids were collected and replated, with the attached Matrigel removed by repeated pipetting, before being transferred into a clean 10 cm petri dish with eight ml of Forebrain third medium (F3M: DMEM/F12, 1x N2 supplement, 1x B27 supplement, 1x GlutaMax, 1x MEM-NEAA, 1x 2-Mercaptoethanol, Pen/Strep, Insulin 2.5 ug/ml). Dishes were incubated at 37°C on an orbital shaker at 80 rpm, with half F3M changes every three days until organoids were used for analysis/experiments. Generation of isogenic clones using CRISPR/CAS9 sgRNAs were designed using the CRISPR design tool www.crispor.tefor.net and selected based on highest efficiencies as well as off-target scores and synthesized by GENESCRIPT with scaffold. ssDNA template was designed with 40bp of homologous nucleotides flanking both arms of the point of mutation, inclusive of silent mutations on, and adjacent to, the PAM region, and synthesized by Sangor Shanghai. Genome editing via homology-directed repair from the CRISPR/Cas9 system in combination with a ssDNA was used to guide the single nucleotide correction of the HDLS point mutation, according to donor’s Sanger sequencing reports on Exon 15 (Donor #2) and 18 (Donor #1) of CSF-1R by homologous recombination. The ribonucleoprotein (RNP) complex consisting of Cas9 protein and sgRNA was assembled using the Trucut V2 (Invitrogen) and Amaxa Human Stell Cell Nucleofector Starter Kit (VPH-5002). The RNP complex was subsequently transfected into dissociated iPSCs by electroporation with Lonza Nucleofector 2B using the Amaxa Human Stem Cell Nucleofector Starter Kit (Lonza) according to manufacturer’s manual. After electroporation, the cells were immediately plated onto Matrigel-coated 6-well plates containing mTeSR1 medium supplemented with 10 µM ROCK inhibitor (Stemcell) and CloneR (Stemcell) at various seeding densities to facilitate the harvesting of clones. After 48 hrs, medium was refreshed with the removal of ROCK inhibitor; subsequently, medium was refreshed daily with the removal of both ROCK inhibitor and CloneR until clones were mature enough for manual picking. Individual clones were manually harvested and plated onto Matrigel-coated 24-well plates with mTesr-1 medium and 10 µM of ROCK inhibitor. GuideRNA and ssDNA template used for targeting HDLS#1 gRNA = TGGTCATGTGGCCAAGACTG ssDNA= GCGCGTAACGTGCTGTTGACCAATGGTCATGTAGCTAAAATCGGGGACT TCGGGCTGGCTAGGGACATCATGAATGACTC (Green nucleotide denotes a silent mutation) GuideRNA and ssDNA template used for targeting HDLS#2 gRNA = GCTCAACTTTCTGTGAAGGA ssDNA= CACGGAGTACTGTTGCTATGGCGACCTGCTCAATTTCCTTCGAAGAAAA GCTGAAGCCATGCTGGGACCCAGCCTGAGCC (Green nucleotide denotes a silent mutation) Clones were screened for SNP editing using the ICE SYNTHEGO tool (https://ice.synthego.com) and off-target events (OTE) screened for using CRISP-ID software (http://crispid.gbiomed.kuleuven.be). Co-culture of forebrain organoids and iMacs to generate iMicroglia Co-culturing iMacs (primitive macrophages) with organoids enables the iMacs to be in a neurogenic niche environment where they would subsequently differentiate into iPSC-derived microglia (iMicro). Thirty thousand day 31 iMacs (mutant or Isogenic controls) were resuspended in F3M before adding onto their isogenic organoid in each well of an ULA 96-well plate. Cocultures were incubated for seven days with daily half F3M change supplemented with CSF-1 (100 ng/ml). On day eight, each organoid was transferred to an individual well of a ULA 24-well plate and supplemented with 1 ml of F3M and CSF-1 (100 ng/ml); half F3M change was performed every three days until analysis. Clearing of forebrain organoids for 3D-imaging Organoids were first fixed in 4% paraformaldehyde for 30 min at room temperature followed by washing twice in PBS then incubating in PBS overnight at 4°C. The next day, PBS was replaced with a permeabilization buffer (2% Triton X-100 in PBS solution) and organoids were incubated on an orbital shaker at room temperature for 72 hrs. At the end of permeabilization, organoids were incubated in blocking buffer (5% normal donkey serum, 5% normal goat serum, 1% Fetal Bovine Serum, 1% Triton X-100 in PBS solution) at 4°C overnight. Organoids were then incubated with primary antibodies at 1:200 in antibody dilution buffer (1% bovine serum albumin, 0.2% Triton X-100 in PBS solution) at 4°C for 72 hrs. Primary antibodies specific for the following markers were used: NESTIN (MERCK ), SOX2 (Abcam), and IBA-1 (Abcam). Organoids were washed in washing buffer (1x PBS solution) on an orbital shaker at room temperature for one hr before being kept in 1x PBS solution at 4°C overnight. The organoids were subsequently incubated with the following secondary antibodies at 1:200 in antibody dilution buffer, at 4°C for 48 hrs: goat anti-mouse Alexa Fluor 488 (Biolegend), goat anti-rabbit Alexa Fluor 594 (Abcam), and donkey anti-goat Alexa Fluor 647 (Abcam). The organoids were then washed with wash buffer for one hr on an orbital shaker at room temperature then kept in PBS at 4°C overnight before counterstaining with the nuclear marker DAPI on an orbital shaker at room temperature for two hrs. Organoids were then washed twice in washing buffer on an orbital shaker at room temperature for one hr, then again kept overnight at 4°C in 1x PBS. The following day, organoids were transferred individually to confocal-imaging-compatible glass-bottomed containers and 20 µl of RapiClear (SUNJin Lab) solution was added onto each organoid and left until they were cleared (usually 24 hrs depending on the size of the organoid). Whole organoids were imaged using a FV3000 confocal microscope with 20× objective lens (Olympus, Japan) and analyzed using iMaris software (BITPLANE). Measurement of area of organoid Area of organoids were measured using ImageJ software. Briefly, the “freehand selection” tool was used to trace the circumference of each individual organoid. The average of three measurements was used as the final readout. Dissociation of forebrain organoids Organoids were collected individually using 200 µl pipette with a cut pipette tip and incubated in 500 µl of Accutase at 37°C with gentle pipetting after 10 min, then allowed to fully dissociate for another 5-15 min at 37°C as needed. After again pipetting, cells were suspended in 1 ml of MACS buffer and collected by centrifugation at 350 g at RT for 5 min. Cells were then used in experiments. Flow cytometry Cells were prepared for labeling by first washing in FACS buffer, then resuspending cells in 70 µl of Fc-block (1:200) and incubating for 20 min at 4°C. Subsequently, the primary antibody cocktails were added into the cells at a 1:200 dilution before being vortexed and incubated for 30 min at 4°C. For samples that required secondary antibody labeling, after incubation with primary antibodies the cells were washed with FACS buffer before secondary antibodies (1:500) were added and incubated for 25 min at 4°C. After a further wash in FACS buffer, DAPI was added then cells were analysed using the BD Symphony X-50. Cell sorting of cocultured organoids Cells were isolated into sorting solution (SMART-Seq HT kit. 10X lysis buffer, RNase inhibitor, 3’ SMART-Seq CDS Primer II A, nuclease-free water) using the BD Aria III cell sorter. After sorting, cell-containing tubes were briefly spun down and immediately placed in liquid nitrogen for snap freezing. Lysates were stored at -80°C. RNA extraction of samples RNA extraction was performed using Trizol according to the manufacturer’s instructions. Briefly, 500 µl of Trizol was added to each sample before the addition of 100 µl of chlorofoam to each sample and mixed thrice (15 sec per succession) before incubating at room temperature for 5 min. Samples were then centrifuged at 20,000g, 20 min, 4°C before the organic solvent was transferred into new eppendorf tubes. One µl of GlycoBlue co-precipitate (Invitrogen) was added to each sample and mixed well before the addition of 250 µl of isoproponol. Samples were mixed well before incubating at -80°C for at least one hr. Thawed samples were subsequently centrifuged at 12,000g, 4°C for 15 min before decanting supernatant, washing again with ice-cold 75% ethanol and centrifuging at 7500g, 4°C for 5 min. Samples were left to air dry for approximately 5 min after decanting of supernatant, before the RNA pellet was resuspended in 10 µl of DPEC water and stored at -80°C. cDNA library construction for RNA-sequencing RNA samples from the previous step were first converted to complementary DNA (cDNA) using the Takara HT kit according to the manufacturer’s instruction. Briefly, 5 µl of purified total RNA was added to 1 µl of 10X reaction buffer consisting of 10X lysis buffer and RNase inhibitor; 1 µl of 3’ SMART-seq primer II A was added and mixed well by vortexing before incubating the samples at 72°C for 3 min. Samples were then immediately placed on ice for 2 min. A one-step master mix consisting of 0.7 µl of nuclease-free water, 8 µl of one-step buffer, 1 µl of SMART-Seq HT oligonucletide, 0.5 µl RNase inhibitor, 0.3 µl SeqAmp DNA polymerase, and 2 µl of SMARTscribe reverse transcriptase was subsequently added to each sample and mixed well. The following program was used to run the PCR protocol: The resulting cDNA product was purified using the Vazyme VAHTS DNA Clean beads. Briefly, 20 µl of beads were added to each cDNA product, mixed well and incubated for 5 min at RT before placing samples on a magnectic stand for 2 min. The supernatant was discarded and cDNA was washed twice with cold 80% ethanol before being air-dried for 3 min. Purified cDNA was subsequently eluted from the magnetic beads with 15 µl of DPEC water. The concentration of cDNA was measured with the Qubit dsDNA HS Assay Kit (Invitrogen) using the Qubit 4 fluorometer. cDNA library construction was performed using the Vazyme TruePrep DNA library prep kit V2 for illumina according to the manufacturer’s instructions. Briefly, the purified cDNA obtained from the previous step was diluted to a final concentration of 1ng/µl with sterile water. Next, 7.5 µl of Mix A ( 2 µl 5x TTBL, 2.5 µl TTE Mix V5, 3 µl DPEC water) was added to 2.5 µl of diluted cDNA and run using the Nextera-1 program at 55°C for 10 min. TSS was immediately added to each sample and left to incubate at RT for 5 min before 7.5 µl of Mix B (2 ul DPEC water, 5 µl 5x TAB, 0.5 µl TAE) was added to each sample. 2.5 µl of N5 and N7 primer was added and mixed well before running on the Nextera-2 program: Subsequently, samples were purified using the vazyme beads and cDNA was eluted with 20 µl of DPEC water before measuring the concentration. For pooling of cDNA libraries, 40 ng of each sample was added to a final volume of 40 µl, adjusted with DPEC water, and incubated with 22.6 µl of Vazyme clean beads at RT for 5 min before magnectic separation. The entire volumn of supernatant was transferred to a fresh PCR tube to which was added 6.4 µl of Vazyme clean beads. The contents were mixed well and incubated at RT for 5 min before separation: subsequently, the supernatant was discarded and bead-bound-cDNA was washed twice with 80% ethanol before being air dried for 3 min. Purified pooled cDNA samples were eluted with 20 µl of DPEC water and tested for concentration. Bulk RNA Analysis The clean paired-ends reads were aligned to the GRCh38.96 human genome reference using kallisto (version 0.46.1) with parameters “–bootstrap-samples=100”. The transcript-level estimated counts belonging to the same gene were then aggregated into the matrix of gene-level counts (TPM) implemented in the R package tximport (version 1.14.2). Pairwise comparison across RNA-seq data was performed to get differentially expressed genes between each two types of cells, using the linear model and the empirical Bayes method implemented in R limma package (version 3.42.2), with significance thresholds for p-value<0.05 and log2(fold change)≥0.5 (Figure 3) or 1.5 (Figure 5). The differentially expressed genes identified with top log2(fold change) were selected to perform the PCA analysis in R using prcomp function. Additionally, the clusterProfiler package (version 4.10.0) was employed for pathway enrichment analysis via the compareCluster function and “enrichGO” method, targeting “ALL” GO ontologies. Metabolic function using Seahorse analysis The bioenergetic profile of iMacs was assessed by determining the oxygen consumption rate (OCR) and the extracellular acidification rate (ECAR) using an XF-96 Flux Analyzer (Seahorse Bioscience). Sensor cartridges (Agilent Technologies) were hydrated in XF Calibrant (Agilent Technologies) at 37°C overnight, devoid of carbon dioxide, following the manufacturer’s instructions. Cells were resuspended in either OCR XF base medium supplemented with 10 mM glucose, 2 mM L-glutamine and 1mM sodium pyruvate, or ECR XF base medium supplemented with 2 mM L-glutamine, before being seeded at 40,000 cells/50 µl/well into XF96 culture plates. Cells were pelleted by centrifugation at 200g for 1 min then resuspended in either 125 µl of OCR or ECR medium per well and incubated at 37°C in a CO2-free incubator for 45 min before loading into the Seahorse analyzer. Cells were sequentially treated with 25 µl injections of specific bioenergtic modulators that were added to the wells prior to loading, to test for different paramters of mitochondrial and glycolytic functions. ECR analysis was probed with 10 mM glucose to stimulate glycolysis, followed by the addition of 2μM oligomycin to block ATP synthase and 50 mM 2-deoxy-glucose (2DG) to shut down the function of glycolysis. Conversely, OCR analysis was probed with 2 μM oligomycin, 1 μM FCCP (carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone) to stimulate maximal mitochondrial oxygen consumption and 0.5 μM rotenone plus antimycin A to asses OXPHOX parameters from the OCR levels. Mitochondrial and glycolytic parameters were calculated as recommended by the instrument manufacturer (Agilent Technologies). MTT Test On the day before testing, 25,000 iMacs were seeded into each well of a 96-well flat-bottom plate. The next morning, 20 µl of MTT solvent (10% of total volume) was added to each well and incubated at 37°C for 3.5 hrs before being decanted. Next, 200 µl of MTT formazan solvent was added to each well before being placed onto a shaker for 15min in the dark, then incubated RT for an additional 30 min in the dark. Measurements were read by a spectrophotometer at OD570 and OD690. Cytospin assay iMacs were first trypsinzed using TryPLE express before being counted using the Countess II. Approximately 50,000 cells were resuspended in 150 µl of PBS before being transferred to a cytocentrifuge cytofunnel paired with a glass slide, and centrifuged for 5 min at 800rpm 200 g, air dried for 30 min before sealing with mounting medium. Images were acquired with an Olympus BX53 light microscope equipped with a 100x oil immersion objective lens. Giemsa staining Adequately air-dried slides were placed in a staining tray and flooded with 1ml per slide of Solution A of the Wright-Giemsa staining kit (BASO) for 1 min. Subsequently, 500 µl of Solution B was added to each slide and agitated for 5 min. Slides were then rinsed in distilled water for 5 min before being air-dried for 30 min then sealed in synthesis resin. Images were acquired with the Olympus BX53 light microscope paired with a 100X oil immersion objective lens. Neuronal cell line SH-5YSY apoptosis induction SH-5YSY cells were kindly provided by the lab of Xu Tien le from the Shanghai Institute of Immunology. SH-SY5Y cell monolayers in sterile PBS were exposed to UV-radiation for 30 min before collection of cells into serum-free medium (DMEM + 1% P/S) and incubation at 37°C overnight to induce apoptosis. The following day, cells were centrifuged at 350 g, RT for 3 min before staining with Annexin V (BD Pharmingen PE Annexin V apoptosis detection kit) for 20 min at RT in the dark, before being analyzed by flow cytometry. Phagocytic assay with conjugated E. coli beads First, pHrodo Red E. coli-conjugated bioparticles (Invitrogen) were reconstituted to a working concentration of 1 mg/ml with sterile water before adding to iMacs in complete medium at 1:10 final concentration. After incubation at 37°C for 45 min, cells were washed twice with PBS before collection for flow cytometry analysis. RNA extraction and real-time quantitative PCR (qPCR) Total RNA was extracted from each group with TRIzol Reagent (Invitrogen). The cDNA was obtained by using the PrimeScript RT Reagent Perfect Real Time kit (Takara, Japan). Briefly, 500 ng of RNA for each sample was amplified as a template, in 10 µl of reaction mixture (2 µl 5X PrimeScript buffer, 0.5 µl PrimeScript RT Enzyme Mix I, 0.5 µl Oligo dT Primer, 0.5 µl random 6-mers, RNA product, RNase-free water). This mixture was then incubated at 37°C for 15 min and subsequently at 85°C for 5 sec to obtain cDNA. qPCR was performed in a ViiA 7 Real-time PCR system (Applied Biosystems) with ChamQ SYBR® Color qPCR Master Mix Low ROX Premixed (Vazyme). Statistical anslysis Statistical tests were performed using GraphPad Prism 8.0.1 (GraphPad Software, La Jolla, CA, USA; www.graphpad.com). All experiments were performed in triplicate and data analysis was performed using unpaired Student’s t-tests. All data represent the mean ± standard error of mean (SEM). Statistical significance was assigned as: p < 0.05 was considered significant: *p < 0.05; **p < 0.01; ***p < 0.001. p > 0.05 was considered nonsignificant (n.s.).
1850
dbpedia
0
9
https://www.orpha.net/en/disease/detail/313808
en
onset leukoencephalopathy with axonal spheroids and pigmented glia
[ "https://www.orpha.net/build/images/logo-orphanet.png", "https://www.orpha.net/build/images/logo-orphanews.png", "https://www.orpha.net/build/images/logo-orphadata.png", "https://www.orpha.net/build/images/logo-ordo.png", "https://www.orpha.net/build/images/logoMain.png", "https://www.orpha.net/build/images/ERN.png", "https://www.orpha.net/build/images/FSMR.png", "https://www.orpha.net/build/images/partners/logo-inserm.png", "https://www.orpha.net/build/images/partners/logo-sante_jeunesse_sports.png", "https://www.orpha.net/build/images/partners/logo-CEE_RDPortal.jpg", "https://www.orpha.net/build/images/partners/logo-AFM.jpg", "https://www.orpha.net/build/images/partners/groupama.jpg", "https://www.orpha.net/build/images/partners/Institut-Francais-de-Bioinformatique-IFB-petit.png", "https://www.orpha.net/build/images/partners/IRDIRC_logo3-Recomm-Recogn.jpg", "https://www.orpha.net/build/images/partners/HVP_Logo.png", "https://www.orpha.net/build/images/partners/GA_logo_100px.png", "https://www.orpha.net/build/images/partners/Logo_CDR-mini.png", "https://www.orpha.net/build/images/partners/gcbr-logo.jpg", "https://www.orpha.net/build/images/ios.gif" ]
[]
[]
[ "" ]
null
[]
null
en
/build/images/favicon.png
null
Knowledge on rare diseases and orphan drugs COVID-19 & Rare diseases Rare Diseases Resources for Refugees/Displaced Persons Homepage > Rare diseases > Search Search for a rare disease * (*) mandatory field Disease name OMIM disease Gene name or symbol ORPHAcode ICD-10 ICD-11 Other search option(s) Alphabetical list Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia Suggest an update Your message has been sent Your message has not been sent. Please contact an administrator. Comment Form X Disease definition Hereditary diffuse leukoencephalopathy with axonal spheroids and pigmented glia is a rare autosomal dominant disease characterized by a complex phenotype including progressive dementia, apraxia, apathy, impaired balance, parkinsonism, spasticity and epilepsy. ORPHA:313808 Classification level: Disorder Synonym(s): ALSP Autosomal dominant leukoencephalopathy with neuroaxonal spheroids FPSG Familial dementia, Neumann type Familial progressive subcortical gliosis GPSC HDLS Hereditary diffuse leukoencephalopathy with spheroids POLD Pigmentary orthochromatic leukodystrophy Subcortical gliosis of Neumann Prevalence: <1 / 1 000 000 Inheritance: Autosomal dominant Age of onset: Adult ICD-10: G93.4 OMIM: 221820 UMLS: C3711381 MeSH: C580150 GARD: 10981 A summary on this disease is available in Français (2014) Español (2014) Nederlands (2014) Detailed information General public Article for general public Svenska (2018) - Socialstyrelsen Guidelines Clinical practice guidelines Deutsch (2022) - AWMF Disease review articles Clinical genetics review English (2017) - GeneReviews : produced/endorsed by ERN(s) : produced/endorsed by FSMR(s) Additional information Further information on this disease Classification(s) (2) Gene(s) (2) Patient-centred resources for this disease Expert centres (236) Networks of expert centre (9) Diagnostic tests (31) Patient organisations (119) Federation/alliance(s) (44) Orphan designation(s) and orphan drug(s) (2) Research activities on this disease Research projects (56) Biobanks (12) Registries (21) Network of experts (7) Newborn screening Newborn screening library The documents contained in this website are presented for information purposes only. The material is in no way intended to replace professional medical care by a qualified specialist and should not be used as a basis for diagnosis or treatment.
1850
dbpedia
3
77
https://ada.com/biomarkers/hdl-cholesterol/
en
HDL cholesterol, known as the “good” cholesterol
https://ada.com/social-default.png
https://ada.com/social-default.png
[ "https://ada.com/_next/image/?url=https%3A%2F%2Fimages.prismic.io%2Fadahealth%2FZhaCMjjCgu4jzubL_ISO_27001_badge.png%3Ffit%3Dcrop%26h%3D160%26w%3D228%26q%3D90&w=64&q=70 1x, /_next/image/?url=https%3A%2F%2Fimages.prismic.io%2Fadahealth%2FZhaCMjjCgu4jzubL_ISO_27001_badge.png%3Ffit%3Dcrop%26h%3D160%26w%3D228%26q%3D90&w=128&q=70 2x", "https://ada.com/_next/image/?url=https%3A%2F%2Fimages.prismic.io%2Fadahealth%2F55915a00-d315-449e-adb7-a4849bfa6e76_ISO-13485.png%3Ffit%3Dcrop%26h%3D160%26w%3D160%26q%3D90&w=48&q=70 1x, /_next/image/?url=https%3A%2F%2Fimages.prismic.io%2Fadahealth%2F55915a00-d315-449e-adb7-a4849bfa6e76_ISO-13485.png%3Ffit%3Dcrop%26h%3D160%26w%3D160%26q%3D90&w=96&q=70 2x" ]
[]
[]
[ "" ]
null
[]
2022-09-21T09:22:28+00:00
Want to learn more about HDL cholesterol? In this article, we’ll explain everything you need to know, with handy tips to keep your levels healthy.
en
/favicon-32x32.png
Ada
https://ada.com/biomarkers/hdl-cholesterol/
You probably know that cholesterol levels are an important measure of your health. In particular, lowering cholesterol can keep your heart and blood vessels healthy. So it might surprise you to hear that there's a "good" kind of cholesterol. High-density lipoprotein (HDL) cholesterol is often nicknamed “good cholesterol.” That's because having high HDL cholesterol levels can actually help reduce your overall cholesterol levels. So what is HDL cholesterol, and why is it named "good?” And what do you need to do to increase your HDL cholesterol levels? Let's find out. What is HDL cholesterol? Your body needs a certain amount of cholesterol to function normally.To transport that cholesterol to where it's needed, your liver produces molecules called lipoproteins. These particles are made up of fats and proteins that bind to cholesterol so your blood can transport it around your body. Your liver produces 2 main types of lipoprotein: High-density lipoproteins (HDLs), or "good cholesterol" Low-density lipoproteins (LDLs), or "bad cholesterol" HDL is the densest and smallest type of lipoprotein, and it contains the highest amount of protein. But what makes HDL cholesterol "good"? Why is HDL cholesterol better than LDL cholesterol? Let's start with a quick cholesterol recap. When your cholesterol levels get too high, fatty buildups can start to form in the walls of your arteries. Over time, these buildups turn to plaques, which can narrow your arteries and make it difficult for blood to flow through. This can increase your chances of developing cardiovascular disease and other conditions including: Heart attack Stroke Chronic kidney disease Now, on to HDL cholesterol. This "good cholesterol" gets its name because: It transports LDL cholesterol, the primary driver of fatty buildups, back to the liver, where it's removed from your body. It can have an anti-inflammatory effect, protecting blood vessels from LDL cholesterol. It can remove existing plaques from artery walls. It has antioxidant effects, which protect chemical messengers and cells in the body. Your HDL cholesterol level provides an important indicator for the health of your cardiovascular system. What is the normal HDL cholesterol range? A healthy HDL cholesterol range is 40 mg per deciliter of blood and higher for men and more than or equal to 50 mg/dL for women. If HDL cholesterol levels go below 50 mg per deciliter of blood for women and 40 mg per deciliter for men, you are 'at risk'. You can determine your HDL cholesterol levels by getting a lipid profile test at your GP. Your doctor will either take a blood sample or do a prick test and carry out a few measurements. These are: Total cholesterol LDL cholesterol HDL cholesterol Triglycerides After taking a lipid profile test, your GP can use the information to carry out a 10-year atherosclerotic cardiovascular disease risk assessment. This will allow them to calculate the risk of you developing heart problems within the next 10 years. How to increase HDL cholesterol? You can increase your HDL cholesterol levels by making healthy lifestyle choices. These can include: Eating a balanced diet Losing weight Exercising regularly Avoiding or quitting smoking Reducing alcohol consumption There are also medications your doctor can prescribe if your HDL cholesterol is low. Wrapping up Not all cholesterol is bad. Having healthy, high HDL cholesterol levels is extremely important for your health. So remember to stay active, eat healthy foods, and make sure you regularly check your blood cholesterol levels. FAqs Q: When should I test my HDL cholesterol? A: You should check your HDL levels as part of your lipid profile with a cholesterol level test every 4 to 6 years. Q: How can I naturally increase my HDL cholesterol levels? A: Lifestyle changes are the main way to naturally increase HDL cholesterol levels. If lifestyle changes aren't enough, your doctor may prescribe medications to help. Q: What impact does my diet have on HDL cholesterol? A: Having a balanced diet is one of the main ways to maintain stable HDL levels. It also contributes to lowering LDL cholesterol, the "bad" kind. Q: Can a high HDL cholesterol level make up for high LDL cholesterol? A: Unfortunately, we do not have the answer to this. More research is necessary to tell for sure. Either way, it's essential to maintain healthy, low LDL levels.
1850
dbpedia
3
2
https://www.webmd.com/cholesterol-management/hdl-cholesterol-the-good-cholesterol
en
Density Lipoprotein): Overview, Safe Levels
https://img.lb.wbmdstati…erol_bigbead.jpg
https://img.lb.wbmdstati…erol_bigbead.jpg
[ "https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/logos/webmd/web/webmd_logo_white.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/library_books.2bf509db.svg", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/articles/biographies/sachdev_poonam_382x382.jpg?resize=51px:51px&output-quality=75", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/BigBead/hdl_cholesterol_bigbead/1800x1200_hdl_cholesterol_bigbead.jpg?resize=750:*", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/more_on/MoreOn_Allergies.jpg?resize=300px:*&output-quality=75", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/cholesterol_hpt_toc_redesign/cholesterol_guide_chapter_4_849177432.jpg?resize=500px:*&output-quality=75", "https://privacy-policy.truste.com/privacy-seal/seal?rid=07326333-3522-463d-81bf-f00fd7171fff", "https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/layout/shared/tag-registered.png?resize=*:60px", "https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/oncology/1/footer-images/ad-choice.png", "https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/oncology/1/images/webmd-logo-white.svg", "https://sb/p?c1=2&c2=6035829&cv=3.9.1&cj=1" ]
[]
[]
[ "" ]
null
[ "Hope Winsborough Matthew Hoffman", "MD Amy Gopal", "www.facebook.com" ]
2008-08-24T20:00:00
HDL (high-density lipoprotein), also known as good cholesterol, reduces the risk of heart diseases. Here's how.
en
https://img.lb.wbmdstati…icon/favicon.png
WebMD
https://www.webmd.com/cholesterol-management/hdl-cholesterol-the-good-cholesterol
What Is HDL Cholesterol? HDL is short for high-density lipoprotein. Each bit of HDL cholesterol is a microscopic blob that consists of a rim of lipoprotein surrounding a cholesterol center. The HDL cholesterol particle is dense compared to other types of cholesterol particles, so it's called high-density. HDL cholesterol is the well-behaved "good cholesterol." This friendly scavenger cruises your bloodstream. As it does, it removes harmful bad cholesterol from where it doesn't belong. High HDL levels reduce your risk for heart disease--but low levels increase the risk. Why Is HDL Cholesterol Good? Cholesterol isn't all bad. In fact, cholesterol is an essential fat. It provides stability in every cell of your body. To travel through your bloodstream, cholesterol has to be transported by helper molecules called lipoproteins. Each lipoprotein has its own preferences for cholesterol, and each acts differently with the cholesterol it carries. Experts believe HDL cholesterol may act in a variety of helpful ways that tend to reduce your risk for heart disease: HDL cholesterol scavenges and removes low-density lipoprotein (LDL) -- or "bad" -- cholesterol. HDL reduces, reuses, and recycles LDL cholesterol by transporting it to the liver where it can be reprocessed. HDL cholesterol acts as a maintenance crew for the inner walls (endothelium) of blood vessels. Damage to the inner walls is the first step in the process of atherosclerosis, which causes heart attacks and strokes. HDL scrubs the wall clean and keeps it healthy. HDL vs. LDL High-density lipoprotein, or HDL, carries cholesterol to your liver. There it gets removed before it has a chance to build up in your arteries. Low-density lipoprotein, or LDL, transports cholesterol directly to your arteries. This can result in a plaque buildup--called atherosclerosis--that can lead to heart attack and stroke. HDL Cholesterol Levels A cholesterol test or lipid panel shows your level of HDL cholesterol. What do the numbers mean? In general, people with high HDL are at lower risk for heart disease. People with low HDL are at higher risk. A lipid panel typically measures five different types of lipids, or fat molecules, in your blood. Measurements are given in milligrams per deciliter (mg/dL): Total cholesterol: Your overall cholesterol level, which is a combination of low-density lipoprotein (LDL), high-density lipoprotein (HDL), and very low-density lipoprotein (VLDL) Low-density lipoprotein (LDL): A type of cholesterol that can collect in your blood vessels, increasing the risk of heart disease; also known as "bad cholesterol" High-density lipoprotein (HDL): A type of cholesterol that helps to decrease buildup of LDL in the blood vessels; also known as "good cholesterol" Very low-density lipoprotein (VLDL): Like LDL, it's also a "bad" form of cholesterol. If you fasted before your lipid panel test, higher-than-normal amounts of VLDL cholesterol are associated with abnormal lipid metabolism. Triglycerides: A type of fat that comes from the foods we eat. Higher amounts of triglycerides are associated with heart disease and inflammation of the pancreas. Optimal HDL Levels The higher your HDL number, the better. The optimal level of HDL to protect you from heart disease is 60 mg/dL or above. However, high levels don't protect you from the negative impact of high LDL. Normal HDL Levels Recommended HDL cholesterol levels vary based on sex: For men and those assigned male at birth (AMAB), HDL levels should be 40 mg/dL or higher to lower the risk of heart disease. For women and those assigned female at birth (AFAB), HDL should be 50 mg/dL or higher to lower the risk. For children ages 2-19, an HDL level of 45 mg/dL or above is considered to be normal. Low HDL Levels Your HDL cholesterol is considered low in these ranges: Men/AMAB: Less than 40 mg/dL Women/AFAB: Less than 50 mg/dL  In general, low levels of HDL can contribute to having a higher level of LDL. That's because HDL cholesterol helps your body get rid of LDL -- the "bad" cholesterol. It moves LDL away from arteries and toward the liver, which eliminates the LDL from your body. If you don't have enough HDL helping to reduce your LDL level, it doesn't lower your risk of heart disease, heart attack, and stroke. There are several causes of low HDL, including: Tangier disease: This genetic condition (inherited from parents) causes low levels of HDL cholesterol. Familial combined hyperlipidemia: People with this inherited condition (passed on from one or both parents) have trouble processing cholesterol. That means HDL cholesterol can be too low and LDL can be too high. Metabolic syndrome: If you have metabolic syndrome, low HDL may be part of it. Multiple health conditions combine in this syndrome and increase risk of heart disease, Type 2 diabetes, and stroke. Overweight/obesity: If you have extra weight, or a body mass index (BMI) higher than 25, your HDL cholesterol is likely to be lower. In addition, lower levels of HDL cholesterol are associated with obesity, especially fat around the abdomen.  Smoking or tobacco use: The nicotine in tobacco lowers your HDL. All tobacco products include nicotine, including e-cigarettes. Medication: Certain medicines may lower HDL levels, such as beta blockers, some diuretics, and others. High HDL Levels For adults, anything above 80 mg/dL is considered high. An abnormally high level of HDL can cause problems, too. In some cases, it may speed up atherosclerosis--the buildup of fats on the artery walls. High HDL cholesterol could be caused by: Genetic mutations: Some changes in your genetic makeup can cause your body to produce too much HDL or have trouble removing it. Primary biliary cholangitis: This disease makes it hard for bile (a fluid your liver makes) to pass through your digestive system. Your body can't break down fats, which can cause high blood cholesterol. Alcohol use disorder: Alcohol consumption is known to raise "good" cholesterol levels. But more isn't necessarily better. Some studies indicate that the increases in HDL from alcohol don't provide any benefit. Drinking also increases your risk of heart disease, stroke, and liver disease.  Medications: Some medicines that help lower LDL cholesterol, such as statins, may also raise HDL cholesterol levels to abnormally high levels.  How to Raise HDL Cholesterol If your HDL is low, you can take several steps to boost your HDL level and reduce your heart disease risk: Exercise. Aerobic exercise for 30 to 60 minutes on most days of the week can help pump up HDL. Quit smoking. Tobacco smoke lowers HDL, and quitting can increase HDL levels. Keep a healthy weight. Besides improving HDL levels, avoiding obesity reduces risk for heart disease and multiple other health conditions. Eat a Mediterranean diet. It has repeatedly been shown to raise HDL levels. The Mediterranean diet consists of healthy fats (mainly olive oil), vegetables, fruits, and whole grains. Limit alcoholic beverages. If you're drinking alcohol, keep your intake to: One drink per day for all women, or for men older than 65 Up to two drinks a day for men 65 and younger In certain cases, your doctor may recommend medication to improve your cholesterol level. Remember that multiple factors besides cholesterol contribute to heart disease. Diabetes, smoking, high blood pressure, obesity, and genetics are all important as well. Because so many factors contribute to heart disease, cholesterol isn't everything. People with normal HDL cholesterol can have heart disease. And people with low HDL levels can have healthy hearts. Overall, though, people who have low HDL cholesterol will have a greater risk of developing heart disease than people with high HDL levels. Experts recommend follow-up cholesterol testing every five years for most people. People with abnormal lipid panels, or who have other risk factors, may need more frequent cholesterol tests. If you have high cholesterol or low HDL levels, take steps to increase HDL cholesterol such as eating right, exercising regularly, and not smoking. Lifestyle changes can make a big difference for most people and may prevent heart disease and stroke. Takeaways The "good" cholesterol, HDL, is important because it's involved in clearing "bad" cholesterol (LDL) from your body. Low levels of HDL can increase your risk of heart disease, heart attack, and stroke. Certain health conditions can lower HDL levels. Lifestyle changes and specific treatment plans can boost your HDL cholesterol to support your overall health. HDL Cholesterol FAQs What is a good level of HDL? For men and those assigned male at birth (AMAB), HDL levels should be 40 mg/dL or higher to lower the risk of heart disease. For women and those assigned female at birth (AFAB), HDL should be 50 mg/dL or higher to lower the risk. The optimal level of HDL to protect you from heart disease is 60 mg/dL or above. Is HDL cholesterol good or bad cholesterol? High-density lipoprotein, or HDL, is considered to be "good" because it carries cholesterol to your liver, where it gets removed before it has a chance to build up in your arteries.  What is a healthy HDL level by age? People 19 and younger: More than 45 mg/dL Men/AMAB 20 and older: More than 40 ml/dL Women/AFAB 20 and older: More than 50 mg/dL How do I raise my HDL? Lifestyle changes can make a difference. Here are some ways to help raise your HDL cholesterol: Exercise for 30-60 minutes most days Quit smoking Avoid obesity by maintaining a healthy weight Eat a Mediterranean diet Drink alcohol in moderation Work with your doctor to address any medical conditions and make any necessary changes in medication to help improve your HDL level. Â
1850
dbpedia
1
78
https://my.clevelandclinic.org/health/diseases/23951-tangier-disease
en
Tangier Disease: Symptoms & Treatment
https://my.clevelandclinic.org/-/scassets/images/org/health/articles/social-share-health-library
https://my.clevelandclinic.org/-/scassets/images/org/health/articles/social-share-health-library
[ "https://my.clevelandclinic.org/health/_next/static/media/gray-gradient-left-16.59910877.svg?w=16&q=75 1x, /health/_next/static/media/gray-gradient-left-16.59910877.svg?w=32&q=75 2x", "https://my.clevelandclinic.org/health/_next/static/media/gray-gradient-right-32.dd7ce4e5.svg?w=32&q=75 1x, /health/_next/static/media/gray-gradient-right-32.dd7ce4e5.svg?w=64&q=75 2x", "https://my.clevelandclinic.org/health/_next/static/media/search--blue.a23a2bb9.svg?w=16&q=75 1x, /health/_next/static/media/search--blue.a23a2bb9.svg?w=32&q=75 2x", "https://my.clevelandclinic.org/health/_next/static/media/logo-ccf.a7ea0118.svg?w=16&q=75 16w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=32&q=75 32w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=48&q=75 48w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=64&q=75 64w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=96&q=75 96w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=128&q=75 128w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=256&q=75 256w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=384&q=75 384w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=640&q=75 640w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=750&q=75 750w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=828&q=75 828w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=1080&q=75 1080w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=1200&q=75 1200w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=1920&q=75 1920w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=2048&q=75 2048w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=3840&q=75 3840w", "https://my.clevelandclinic.org/health/_next/static/media/search--gray.86f52a63.svg?w=32&q=75 1x, /health/_next/static/media/search--gray.86f52a63.svg?w=48&q=75 2x", "https://zdbb.net/l/Dnl1wmWs8xCCpvWNCt9Egf/?w=16&q=75 1x" ]
[]
[]
[ "" ]
null
[]
2023-08-28T17:18:10+00:00
Tangier disease is a very rare genetic issue that makes your body have low levels of HDL or “good cholesterol.” This may make you more likely to get heart disease.
en
https://my.clevelandclinic.org/assets/imgs/favicon.ico
Cleveland Clinic
https://my.clevelandclinic.org/health/diseases/23951-tangier-disease
What is Tangier disease? Tangier disease is a rare condition you can get from your parents. People with Tangier disease have very low levels of HDL (high-density lipoprotein). This type of cholesterol is known as “good cholesterol” because it helps get rid of the bad kind of cholesterol (LDL or low-density lipoprotein) that clogs your arteries. Tangier disease can affect multiple organs in your body and can give you a higher risk of heart disease, which can lead to a heart attack or stroke. Why is it called Tangier disease? The name for this disease comes from Tangier Island, which is off the coast of the commonwealth of Virginia in the United States. This is where people discovered the first cases of Tangier disease. However, people in other parts of America and the world have it too. How common is Tangier disease? Tangier disease is extremely rare. Healthcare providers have diagnosed about 100 cases of it throughout the world. How does Tangier disease affect my body? In people with Tangier disease, fat (lipids) can build up because there’s not enough HDL to carry it to your liver, which gets rid of it. This collection of fat enlarges certain body parts, such as: Liver. Spleen. Tonsils (these can look yellow or orange). Lymph nodes (part of your immune system). Heart. Brain. You may also have: Nerve issues. High triglycerides. An unusual cloudiness in your eyes that can make it hard to see if it’s bad enough. What are the symptoms of Tangier disease? Tangier disease symptoms are different from person to person, depending on where the fatty deposits settle. Symptoms can include: Pain in your stomach or feeling sick to your stomach. Plaque collecting in your arteries (atherosclerosis). Dry skin. Ectropion (your eyelid flips inside out). Anemia. Muscle weakness in your arms, legs hands or feet. Long-term lymph node swelling that doesn’t come from an infection. Symptoms can appear at any time from shortly after birth to age 65. What causes Tangier disease? You inherit Tangier disease through the _ABCA1 _gene you get from your parents. When this gene is abnormal, a problem with its instructions makes your body unable to move cholesterol out of your cells and into HDL. HDL takes bad cholesterol to your liver, which gets rid of it. If you get an abnormal ABCA1 gene from each of your parents, you’ll have Tangier disease. If you get an abnormal gene from only one parent, you become a carrier for Tangier. You may not show signs of Tangier, but still can have low HDL. If two parents who are carriers for the abnormal gene have a child, that child — regardless of gender — may: Have Tangier disease (25% chance). Be a carrier (50% chance). Not inherit an abnormal gene from either parent (25% chance). How is Tangier disease diagnosed? Your healthcare provider can make a Tangier disease diagnosis after doing a physical exam and doing blood tests for HDL and one of its proteins. Genetic testing can confirm the diagnosis. If you can’t get a genetic test, your provider can take a tissue sample (biopsy) from several parts of your body. Which protein is deficient in Tangier disease? You have a very small amount of apolipoprotein A1 (ApoA1) when you have Tangier disease. This protein is part of HDL, which is also low in people with this disease. Advertisement Which tests are used for Tangier disease? Tests to help with a Tangier disease diagnosis or to monitor the disease’s effects may include: Nerve and muscle studies (electromyograms). Eye exam. Ultrasound on your belly (abdomen). Ultrasound on your carotid arteries. CT angiogram of your heart. Echocardiogram. Exercise stress test.
1850
dbpedia
2
95
https://sistershopefoundation.org/about-us/
en
Sisters' Hope Foundation
https://i0.wp.com/sister…it=32%2C32&ssl=1
https://i0.wp.com/sister…it=32%2C32&ssl=1
[ "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/06/Sisters_Hope_Foundation_Color_900x900.png?fit=1020%2C1020&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/06/Sisters_Hope_Foundation_White_900x900.png?fit=1020%2C1020&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2024/03/Sisters-Hope-Staff-and-Board3.png?fit=1020%2C199&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/07/Heidi-Edwards_Pink_620x620px.png?resize=620%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/06/Erin-Sullivan_Pink_620x620px.png?resize=620%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/06/Kim-Cade_Pink_620x620px.png?resize=620%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/06/Christopher-Forbes_Pink_620x620px.png?resize=620%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2023/06/Tara-Parker_Pink_620x620px.png?resize=620%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2024/03/Kasey-Feldt_Pink_620x620px.jpg?resize=621%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2024/03/Jillian-OToole_Pink_620x620px.jpg?resize=621%2C620&ssl=1", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2024/03/Danielle-Donadio_Pink_620x620px.jpg?resize=621%2C620&ssl=1", "https://sistershopefoundation.org/wp-content/uploads/2024/01/Researcher-Icon.svg", "https://sistershopefoundation.org/wp-content/uploads/2024/02/Book-icon.svg", "https://i0.wp.com/sistershopefoundation.org/wp-content/uploads/2024/02/[email protected]?fit=295%2C300&ssl=1", "https://sistershopefoundation.org/wp-content/uploads/2023/06/Sisters_Hope_Foundation_Color_900x900.png", "https://sistershopefoundation.org/wp-content/uploads/2023/06/profile-GOLD2024-seal.svg", "https://scontent-lax3-2.cdninstagram.com/v/t51.2885-15/456083871_805579875063923_4944505624549503739_n.jpg?_nc_cat=106&ccb=1-7&_nc_sid=18de74&_nc_ohc=XmZs_URe8psQ7kNvgH4Jru6&_nc_ht=scontent-lax3-2.cdninstagram.com&edm=ANo9K5cEAAAA&oh=00_AYBXqXSNxUeLTJ_B0RpJbxZsGFb19xHC9p7nW-g5V6oYZw&oe=66C961DA", "https://scontent-lax3-2.cdninstagram.com/v/t51.2885-15/455977143_389748623820276_4537176532037984740_n.jpg?_nc_cat=111&ccb=1-7&_nc_sid=18de74&_nc_ohc=FW51X8HGENwQ7kNvgGIZBqk&_nc_ht=scontent-lax3-2.cdninstagram.com&edm=ANo9K5cEAAAA&oh=00_AYAsaITnzn8jgtcJKznsvaUNKbDGmeTkw-4ElqK4uLLX4Q&oe=66C948E8", "https://scontent-lax3-1.cdninstagram.com/v/t51.2885-15/455822638_3661291347470291_7013521635617842599_n.jpg?_nc_cat=105&ccb=1-7&_nc_sid=18de74&_nc_ohc=eryFus9ksfEQ7kNvgGuNjFS&_nc_ht=scontent-lax3-1.cdninstagram.com&edm=ANo9K5cEAAAA&oh=00_AYAt_x0xHt_mPiTE0nfRjFReIMXyZgg1r0Ck8zfPhyjPXg&oe=66C945D6", "https://scontent-lax3-1.cdninstagram.com/v/t51.2885-15/455696012_1151007499314596_5500384068666921863_n.jpg?_nc_cat=108&ccb=1-7&_nc_sid=18de74&_nc_ohc=QFjb65dTAtEQ7kNvgE1QhyK&_nc_ht=scontent-lax3-1.cdninstagram.com&edm=ANo9K5cEAAAA&oh=00_AYAWpsp4Kz3VBiU9vkf-zMirXLsUR0uNn9By5kDNjcDacw&oe=66C946BF" ]
[]
[]
[ "" ]
null
[ "heidi3d36319bfd" ]
2023-07-03T08:45:52-07:00
Through Sisters’ Hope Foundation we envision a world where those affected by HDLS/ALSP have support and knowledge, leading to a better quality of life and one
en
https://i0.wp.com/sister…it=32%2C32&ssl=1
Sisters' Hope Foundation
https://sistershopefoundation.org/about-us/
In 2009 we noticed similar personality changes in my Mom. Doctors told us that she had a different disease than her sister, but what became clear was this condition seemed hereditary. There was also no cure and available treatments. Two years after her diagnosis, my Mom passed away of the illness. In the final stages of my Mom’s illness her brother – my Uncle Chuck – began to have unexplained memory lapses, and became lost driving to work; a route he had driven for 32 years. When this happened, we all felt certain that he had “the disease.” Uncle Chuck passed away a year after my mother. Shortly after my uncle’s death, neurologists from the University of Pennsylvania who had been following my family’s story requested a family meeting. They had identified the mutated gene affecting our family, the CSF1R gene and identified the condition as Hereditary Diffuse leukodystrophy with spheroids. We finally had the right diagnosis. Because the CSF1R gene mutation is autosomal dominant, we also understood that anybody directly related had a 50% chance of inheriting the gene. I got tested for the CSF1R mutation and it came back negative. My family members chose not to get tested. In 2019 my sister, Heather, became symptomatic and at the same time my twin sister Holly began exhibiting behavioral and speech changes. A new neurologist on the UPenn neurology team told us of a bone marrow transplant treatment program underway at the University of Minnesota, so I volunteered and found out that I was a 100% match for my sister Heather. 15 days after the transplant Heather suffered a heart attack. Holly in the meantime had a seizure and was diagnosed with the disease. Heather began to reject the bone marrow and continued to be hospitalized (Heather was never released from the hospital). She died in August 2020. Holly decided against the transplant for fear that it would accelerate the disease as it had with her sister. She lived out her final 11 months with her son and family by her side. She passed away on July 20, 2021. Despite these tragic events; we remain hopeful. I started the Sisters Hope Foundation to raise awareness and education of ALSP. For so long, I felt alone with this disease and like I should do more for my sisters’ children and other families. I want to connect people affected by this illness to build community and support, so others don’t feel alone. I want to advocate for research and funding to improve treatment options. It’s too late to save my sisters and other family members, but I advocate every day for my niece and nephews, and others who may get this diagnosis. Through the work of Sisters’ Hope Foundation, I hope we see the first survivor of ALSP.
1850
dbpedia
0
35
https://www.frontiersin.org/journals/genetics/articles/10.3389/fgene.2019.00491/full
en
A Novel Splicing Mutation in the CSF1R Gene in a Family With Hereditary Diffuse Leukoencephalopathy With Axonal Spheroids
https://images-provider.…0-00491-g001.jpg
https://images-provider.…0-00491-g001.jpg
[ "https://loop.frontiersin.org/images/profile/523808/32", "https://loop.frontiersin.org/images/profile/603409/32", "https://loop.frontiersin.org/images/profile/532901/32", "https://www.frontiersin.org/article-pages/_nuxt/img/crossmark.5c8ec60.svg", "https://loop.frontiersin.org/images/profile/457263/74", "https://loop.frontiersin.org/images/profile/302612/74", "https://loop.frontiersin.org/images/profile/664755/74", "https://loop.frontiersin.org/images/profile/533049/74", "https://www.frontiersin.org/files/Articles/438237/fgene-10-00491-HTML/image_m/fgene-10-00491-g001.jpg", "https://www.frontiersin.org/files/Articles/438237/fgene-10-00491-HTML/image_m/fgene-10-00491-g002.jpg", "https://www.frontiersin.org/files/Articles/438237/fgene-10-00491-HTML/image_m/fgene-10-00491-g003.jpg", "https://www.frontiersin.org/files/Articles/438237/fgene-10-00491-HTML/image_m/fgene-10-00491-g004.jpg" ]
[]
[]
[ "Hereditary diffuse leukoencephalopathy with axonal spheroids", "Csf1r", "Neuroimages", "Whole-exome sequencing", "splicing mutation" ]
null
[]
null
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) is a rare autosomal dominant disorder that typically presents with early-onset cognitive ...
en
https://brand.frontiersi…on-Frontiers.png
Frontiers
https://www.frontiersin.org/journals/genetics/articles/10.3389/fgene.2019.00491/full
Introduction Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) is a rare autosomal dominant disorder characterized by cerebral white matter degeneration and corpus callosum atrophy (Axelsson et al., 1984). It is clinically characterized by adult-onset neuropsychiatric symptoms, progressive cognitive decline, motor and gait disturbances, urinary incontinence, and even seizures (van der Knaap et al., 2000; Wider et al., 2009; Sundal et al., 2012). Neuropathological features of HDLS include a widespread loss of myelin and axons, astrocytosis, and macrophages in the presence of axonal swellings (spheroids) (van der Knaap et al., 2000; Wider et al., 2009). Recently, mutations in the colony stimulating factor 1 receptor (CSF1R) gene were identified as the causative gene of HDLS (Rademakers et al., 2011). To date, more than 60 genetic loci mutations have been linked to HDLS (Guerreiro et al., 2013; Konno et al., 2017; Lynch et al., 2017; Adams et al., 2018; Miura et al., 2018). Most of the mutations were located in the tyrosine kinase domain of the protein (Lynch et al., 2017). In our present study, we report a novel splicing mutation (c.1858+1G>T) in the CSF1R gene in a family with HDLS. In vitro RT-PCR analysis showed that this splice-site mutation resulted in the deletion of exon 13 from mRNA encoded by the CSF1R gene. Our findings expand the molecular and phenotypic spectrum of CSF1R mutation-induced HDLS, which will be useful for screening and the genetic diagnosis of HDLS. The large clinical heterogeneity in the same family who had the same mutation indicates that modifying genes and environmental factors may play a role in the pathogenesis of HDLS. Case Presentation The proband was a 37-year-old man who was referred to our hospital with a 7-month history of progressive weight loss, slurred speech, limb stiffness, and blunt response. Seven months ago, the patient suffered from rapid emaciation with 20-kg weight loss in 2 months. Then, the patient gradually developed dysarthria and occasionally choked when drinking water. Three months later, the patient had upper limb tremors and clumsy hands. Four months later, blunt response, memory loss, and irritability were observed by his family. In the course of the disease, the patient had constipation, accompanied by sweating and sebaceous gland hypersecretion. He denied fever, headache, loss of consciousness, convulsions, muscular atrophy or fibrillation. The medical history information was collected in Feb 2018 when he was admitted to the inpatient department of our hospital. His parents, one elder brother, two elder sisters, and his son are all physically healthy. On examination, he (high school degree) had a significant global cognitive decline with a mini-mental state examination (MMSE) score of 18/30 and a Montreal cognitive assessment scale (MoCA) score of 15/30. He had obvious dysarthria with bilateral reduced palatal movements, indicating pseudobulbar palsy. Tone was increased in the neck and right limbs. Hyperreflexes of the legs with ankle clonus were noticed, but bilateral pathological signs were negative. His gait had a slow and shuffling characteristic, and he had difficulty turning around. Both upper limbs showed slight postural tremor and clumsy rotation. Finger-nose coordination was slow with mild intention tremor, and poor heel–knee coordination was found on the left limbs. Blood laboratory tests were normal/negative, including the serum erythrocyte sedimentation rate, C-reactive protein, vitamins (B1\B2\B6\B9\B12), thyroid function, adrenocorticotropic\sex hormone, renin-angiotensin-aldosterone, and antinuclear antibodies. Cerebrospinal fluid analysis of paraneoplastic antibodies, antibodies specific for demyelinating diseases of the central nervous system, autoimmune encephalitis and oligoclonal IgG bands were normal/negative. Syphilis serology and HIV tests were negative. Brain T2 fluid-attenuated inversion recovery (Flair) and diffusion-weighted imaging (DWI) MRI showed multiple, patchy, symmetrical, and hyperintense lesions in the periventricular areas, corpus callosum, and deep white matter regions of the frontal and parietal lobes. The splenium of the corpus callosum showed a homogeneous hyperintense signal in both Flair and DWI. With disease progression, patchy white matter lesions, which were initially small dots, became more widespread and confluent in this patient. DWI images showed a sustained intense signal over time, which is very unlike DWI high signal in stroke disease. An MRI scan also showed enlarged lateral ventricles (Figures 1-1A–D). FIGURE 1 Histopathological examination of brain biopsy showed white matter lesions with myelin and axon damage and neuroaxonal swelling (spheroid formation), accompanied by prominent gliosis in the frontal lobe (Figures 1-2A,B). The activated microglia and phagocytic cells appeared to be segregated (Figures 1-2C–G). Electron microscopy confirmed the loss of myelin and axons. The axons were swollen and spherical (Figure 1-2H). Spheroids had a thin and discontinuous myelin sheath or no myelin sheath. Large numbers of neurofilaments and organelles were observed in the axoplasm (Figure 1-2I). Whole-Exome Sequencing Peripheral blood samples were collected from the proband, and genomic DNA was extracted from peripheral blood lymphocytes by using an Automated Nucleic Acid Extractor (QIAGEN, Hilden, Germany). Whole-exome sequencing (WES) of the proband was performed by Axeq Technologies (RayLee Biotech, Shanghai, China) using Agilent SureSelect v6 reagents for capturing exons and Illumina HiSeq X Ten platform for sequencing. The percentage of coverage and average depth for WES were 97.86% and 110.5X, respectively. The sequencing reads were aligned to GRCh37.p10 using Burrows-Wheeler Aligner (BWA) software. Reads that aligned to exon regions were collected for mutation identification and subsequent analysis. SAMTools mpileup and bcftools were used to perform variant calling and identify single nucleotide polymorphisms (SNPs) and indels. The called single nucleotide variants (SNVs) and indels were annotated with ANNOVAR. No known variants in the CSF1R gene were found, while the WES test in the proband showed a c.1858+1G>T mutation in exon 13 of CSF1R (Figure 2A), which is a novel mutation of CSF1R. This mutation was not found in the Exome Aggregation Consortium, The Human Gene Mutation Database (HGMD), and the 1,000 Genomes Project (1000G). A gene database analysis using Mutation Taster indicated this mutation as “disease causing.” According to the American College of Medical Genetics and Genomics guideline (Richards et al., 2015), this mutation was predicted to be pathogenic. FIGURE 2 The heterozygous novel mutation identified through WES was verified through Sanger sequencing in all available family members. The same mutation was found in his mother (I:2), brother (II:3), the second elder sister (II:6), and his son (III:5), indicating an autosomal dominant pattern of inheritance (Figure 2B). His mother (age 68), elder brother (age 45), and the second elder sister (age 43) all had complaints of mild memory loss, which did not affect daily life. His 14-year-old son was normal. All of them underwent a 1.5 T MRI scan. Hyperintense lesions within the white matter were found in his mother (Figure 3A), elder brother (Figure 3B), and elder sister (Figure 3C), but much less than this patient, indicating that this mutation had different penetrance among family members. The 14-year-old son had normal brain images so far (Figure 3D). We assumed that he had not yet reach the age of onset. FIGURE 3 Transcription Analysis To determine whether the mutation could affect the splicing of mRNA, mutated (MT) CSF1R, which carries the disease-causing c.1858+1G>T mutation and wild-type (WT) CSF1R minigenes, was cloned into the pcDNA3.1 expression vector. pcDNA3.1-CSF1R-WT, pcDNA3.1-CSF1R-MT, and the control pcDNA3.1 (+) plasmids were transiently transfected into 293T cells. We then carried out RT-PCR with primers spanning a region from exon 12 to exon 14 and then separated the products on 2% agarose gels. RNA extracted from cells transfected with wild-type plasmid produced a 340 bp band corresponding to the correct splicing of mRNA, while we detected a truncated product band that was smaller than the wild-type product in cells transfected with the mutated plasmid, thus indicating that an abnormal alternatively spliced isoform was produced by the mutation one base before the splice donor site of exon 13. No band was detected in the cells transfected with pcDNA3.1 (+) control (Figure 4A). The products were purified and confirmed by Sanger sequencing, and sequencing analysis showed that the splice-site mutation caused the deletion of exon 13 of the CSF1R gene during mRNA splicing (Figures 4B,C). FIGURE 4 Discussion The age of onset of HDLS varies from 15 to 78 years but usually occurs in the third or fourth decade (Wong et al., 2011). Clinical symptoms often start with neuropsychiatric problems, including behavioral changes and cognitive declines, followed by or concurrent with motor and gait disturbances caused by pyramidal, extrapyramidal or cerebellar damage. Resting/postural tremor, urinary, and fecal incontinence also commonly developed (Konno et al., 2017). In the present case, age of onset, dysarthria, motor and gait disorder, cognitive decline, sweating and constipation, and tremors are all typical symptoms of HDLS except the 20-kg weight loss in 2 months without any evidence of loss of appetite, tumor, infection or even vasculitis. Obvious weight loss has never been mentioned in the clinical spectrum of HDLS. MRI images are marked with bilateral, asymmetrical or symmetrical, patchy or diffuse/confluent T2 hyperintensities along/within periventricular, deep white matter, subcortical of frontal and/or parietal lobes. Diffusion-weighted MRI demonstrates restricted diffusion within white matter lesions that are different from other leukodystrophies, including metachromatic leukodystrophy and X-linked adrenoleukodystrophy. MRI of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) might also demonstrate restricted diffusion and diffuse/confluent white matter lesions. However, CADASIL usually has stroke-like episodes, anterior temporal lobe commonly affected, obvious cerebral infarcts, and microbleeding revealed by SWI. In the presented family, the patient exhibited a rapidly progressive trend from patchy white matter lesions to confluent lesions in just 4 months. Other members carried the same CSF1R mutation but had very mild patchy localized lesions corresponding to mild complaints of forgetfulness, indicating very uneven penetrance and quite different disease progression among family members. Some patients with CSF1R mutations might have no or mild symptoms with a very slow disease progression. The genetic basis of HDLS, mutations in the CSF1R gene on chromosome 5q32, was first elucidated by Rademakers. Functional studies suggested that the mutations affect the kinase activity of the protein, most likely altering the phosphorylation of downstream target (Rademakers et al., 2011). The CSF1R gene encodes a cell-surface receptor containing five immunoglobulin-like domains in the extracellular ligand-binding portion, a single transmembrane domain, and an intracellular tyrosine kinase domain (Pixley and Stanley, 2004). The normal function of CSF1R is essential for proliferation, survival, proliferation, and differentiation of mononuclear phagocytic cells, including microglia in the central nervous system (Stabile et al., 2016). To date, more than 60 genetic loci mutations have been linked to HDLS (Figure 4D) (Guerreiro et al., 2013; Konno et al., 2017; Lynch et al., 2017; Adams et al., 2018; Miura et al., 2018). Almost all of the mutations in CSF1R associated with HDLS are located in the tyrosine kinase domain of the CSF1R protein, encoded by exons 12–21 of the genes (Lynch et al., 2017). Only one frameshift mutation caused by a single nucleotide deletion (c.310delC) in exon 4 resulted in p.Pro104LeufsTer8 located outside of the tyrosine kinase domain (Miura et al., 2018). No disease-associated mutations have been detected in exon 16, and only two have been detected in exon 15 of the gene, suggesting that this domain is not crucial in the pathological pattern of HDLS. Eight splice-site mutations are associated with HDLS, 5 of which are located in intron 18 (Rademakers et al., 2011; Guerreiro et al., 2013; Konno et al., 2014, 2017; Kawakami et al., 2016). The mutation we identified is located at the splice site of intron 13 within the tyrosine kinase domain. RNA splicing is the process during which introns are excised and exons are spliced. These splice donor sites and splice acceptor sites are highly conserved during evolution. The precise recognition of splicing signals is critical to this process. Mutations that affect splicing can cause disease directly or contribute to the severity or susceptibility of disease. It is estimated that approximately 10% of disease-causing mutations affect splicing, and mutations at these splice sites have been found to be associated with a considerable proportion of genetic disorders (Lopez-Bigas et al., 2005; Ward and Cooper, 2010). Splice-site mutations usually lead to abnormal pre-mRNA splicing, which results in exon skipping and activation of cryptic splice sites. Regarding the phenotypic effects of mutations on mRNA splicing, exon skipping occurred more frequently than cryptic splice-site usage (Pridans et al., 2013; van der Klift et al., 2015). From our results, we found that the splice donor site mutation in intron 13 (c.1858+1G>T) of CSF1R caused exon 13 skipping from the CSF1R mRNA, which may further affect the function of the CSF1R protein. We described detailed clinical, neuroimaging, neuropathological, and genetic analyses of an family with HDLS with different penetrance and disease progression among family members. A novel CSF1R mutation, c.1858+1G>T, located in exon 13, provides an abnormal splice site causing exon 13 to be skipped at the mRNA level, which might lead to abnormal function of the CSF1R protein. Thus far, whether CSF1R mutations result in gain of function, producing dominant negative repressors, or inducing loss of function is controversial. Further research is required to elucidate the detailed molecular mechanism of the CSF1R mutation leading to HDLS. Ethics Statement We obtained written informed consent for genomic analysis of the patient and his family members in accordance with the Declaration of Helsinki. The project was approved by the ethics committee of the Ruijin Hospital Affiliated to Shanghai Jiaotong University School of Medicine. The proband and his family members provided written informed consent for the publication of the patient’s identifiable information. Author Contributions QX conceived and designed the experiments; QX and YT helped in patient workup and recruitment of the patients and their family members; YT helped in genetic analysis; XY and PH performed the experiments and wrote the paper. All authors analyzed and interpreted the data for the study. Funding This work was supported by grants from the National Key R&D Program of China (Grant No. 2016YFC1306000), the National Natural Science Foundation of China (Grant Nos. 81801254 and 81870998), the Key Field Research and Development Program of Guangdong Province (Grant No. 2018B030337001), the Shanghai Sailing Program (Grant No. 18YF1414000). Conflict of Interest Statement The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgments We thank all the family members for their participation in the study. References
1850
dbpedia
3
3
https://www.healthline.com/health/high-hdl
en
High HDL Cholesterol: Can It Be a Problem?
https://media.post.rvohe…_Be_Too_High.jpg
https://media.post.rvohe…_Be_Too_High.jpg
[ "https://i0.wp.com/post.healthline.com/wp-content/uploads/2018/09/GrahamRogers.png?w=105&h=105", "https://i0.wp.com/post.healthline.com/wp-content/uploads/2018/09/GrahamRogers.png?w=105&h=105", "https://i0.wp.com/post.healthline.com/wp-content/uploads/2021/12/Kris-Gunnars-500x500-Bio.png?w=73&h=73", "http://b.scorecardresearch.com/p?c1=2&c2=38584006&cv=3.9&cj=1&" ]
[]
[]
[ "high hdl" ]
null
[ "Kristeen Cherney" ]
2017-03-27T07:00:00+00:00
Doctors usually recommend having high levels of HDL cholesterol, but in some rare cases HDL levels can be too high. Learn more.
en
https://images-prod.heal…e-touch-icon.png
Healthline
https://www.healthline.com/health/high-hdl
Research published by the journal Arteriosclerosis, Thrombosis, and Vascular Biology found that people with high levels of C-reactive proteins after having had a heart attack may process high HDL negatively. C-reactive proteins are produced by your liver in response to high levels of inflammation in your body. Instead of acting as a protective factor in heart health, high HDL levels in these people could instead increase the risk of heart disease. While your levels may still be in the normal range, your body may process HDL differently if you have this type of inflammation. The study looked at blood drawn from 767 nondiabetic people who had recently had a heart attack. They used the data to predict outcomes for the study participants and found that those with high levels of HDL and C-reactive proteins were a particularly high-risk group for heart disease. Ultimately, more research needs to be done to determine the risks of high HDL in this particular group of people. Other conditions and medications associated with high HDL High HDL is also linked to other conditions, including: thyroid disorders inflammatory diseases alcohol consumption Sometimes cholesterol-controlling medications can also raise HDL levels. These are usually taken to lower LDL, triglyceride, and total cholesterol levels. Medication types that have been linked to increased HDL levels include: bile acid sequestrants, which decrease fat absorption from the foods you eat cholesterol absorption inhibitors omega-3 fatty acid supplements, which lower triglycerides in the blood, but also increase HDL cholesterol statins, which block the liver from creating more cholesterol Increasing HDL levels is usually a positive side effect in people who have low HDL levels as in most cases, it decreases their risk of developing cardiovascular disease. A blood test can determine your HDL levels. In addition to an HDL test, your doctor will also look for LDL and triglyceride levels as a part of an overall lipid profile. Your total levels will also be measured. Results usually take just a few days to process. Certain factors can influence the results of your test. Talk to your doctor if: you’ve recently been ill you’re pregnant you’ve given birth in the last six weeks you hadn’t been fasting before the test you’re more stressed than usual you’ve recently had a heart attack All these factors can lead to inaccurate measurements of HDL in the blood. You may need to wait several weeks before taking a cholesterol test to make sure the results are correct. In most people, high HDL is not harmful, so it doesn’t necessarily require treatment. The action plan depends largely on how high your levels are, as well as your overall medical history. Your doctor can help determine whether you need to actively lower HDL levels or not. Your overall cholesterol levels may be decreased by: not smoking drinking alcohol in moderate amounts only (or not at all) getting moderate exercise reducing saturated fats in your diet managing underlying health conditions, such as thyroid diseases The American Heart Association recommends that everyone over the age of 20 gets a cholesterol test every four to six years. You may need to test more frequently if you have risk factors for high cholesterol, such as family history. More research is needed to further understand how high HDL can be harmful in certain people. If you have a personal or family history of either high cholesterol levels or C-reactive proteins, talk to your doctor about steps you can take to regularly monitor your HDL levels.
1850
dbpedia
1
80
https://www.massgeneral.org/news/press-release/genetic-testing-for-a-lipoprotein-linked-to-cardiovascular-risk-is-as-effective-as-blood-work
en
Genetic testing for a lipoprotein linked to cardiovascular risk is as effective as blood work, study shows
https://www.massgeneral.…Campus-River.jpg
https://www.massgeneral.…Campus-River.jpg
[ "https://www.massgeneral.org/assets/MGH/images/logos/mgh-logo-rgb.svg", "https://www.massgeneral.org/assets/MGH/images/river-shield-400x225.jpg", "https://www.massgeneral.org/assets/MGH/images/MGH/res-inno-megamenu400x225.jpg", "https://px.massgeneral.connecthealthcare.com/Custom/Photos/HiRes/3641.jpg", "https://www.massgeneral.org/assets/MGH/images/logos/logo-mgh--white.svg", "https://www.massgeneral.org/assets/MGH/images/logos/hms_th--white.svg", "https://www.massgeneral.org/assets/MGH/images/logos/mgpo--white.svg", "https://www.massgeneral.org/assets/MGH/images/logos/MassGeneralBrigham-white.svg", "https://www.massgeneral.org/assets/MGH/images/logos/proto.svg" ]
[]
[]
[ "" ]
null
[ "Julie Cunningham" ]
null
en
/assets/MGH/images/favicon/apple-touch-icon.png
Massachusetts General Hospital
https://www.massgeneral.org/news/press-release/genetic-testing-for-a-lipoprotein-linked-to-cardiovascular-risk-is-as-effective-as-blood-work
BOSTON – Elevated levels of a little-known lipoprotein in the blood that may put people at high risk of cardiovascular disease can be as accurately detected by genetic testing as by conventional laboratory measurement, researchers at Massachusetts General Hospital (MGH) have found. In a study published in JAMA Cardiology, the team reported that genetic risk scoring of the low-density lipoprotein (LDL)-like lipoprotein – known as lipoprotein(a) – may have clinical utility in helping physicians identify candidates for treatment, such as a statin, or for ongoing clinical trials of new medicines. The findings are particularly important in light of the millions of people who use direct-to-consumer genetic testing kits, and for expanding genetic research biobanks. “Our work demonstrates that genetic risk scoring of lipoprotein(a) offers risk prediction of atherosclerotic cardiovascular disease that’s comparable to directly measured lipoprotein(a),” says Pradeep Natarajan, MD, investigator in the Division of Cardiology and Cardiovascular Research Center at MGH and senior author of the study. “We learned that genetic determinants of elevated lipoprotein(a) may help identify the most effective medication regimen for cardiovascular disease prevention.” Lipoprotein(a) contains a molecule known as apolipoprotein(a) that has been linked by studies to atherosclerotic cardiovascular disease (ASCVD). Genetic variation is believed to account for 75 to 95 percent of lipoprotein(a) level variation in the population. Because nongenetic factors, such as diet and physical activity, do not substantially influence lipoprotein(a) concentrations, a genetic test is well positioned to identify high concentrations. Lipoprotein(a) levels greater than 50 milligrams per deciliter (mg/dL) are associated with a 30 to 50 percent greater risk of ASCVD. Individuals with extremely high levels, greater than 200 mg/dL, could face a three to four times greater risk of ASCVD. Unlike LDL and HDL cholesterol and other lipoprotein particles that are universally known, lipoprotein(a) is rarely measured and largely underrecognized by physicians. Through their observational study, the MGH researchers sought to determine if the 43 known genetic variants of lipoprotein(a) could predict future disease risk. To that end, they drew upon the UK Biobank’s approximately 500,000 adults ages 40 to 69. “Our results showed that if someone already had their lipoprotein(a) measured, then the incremental predictive benefit of a genetic test is negligible,” notes Mark Trinder, with the University of British Columbia, lead author of the study. “Where both findings can be useful, though, is in the case of physicians who are undecided about putting a patient with elevated lipoprotein(a) levels on medication.” Natarajan is encouraged about the potential impact of his team’s work on the broader realm of genetic testing. “Using genetic factors enhances our ability to identify at-risk individuals for cardiovascular disease who could benefit from earlier preventive strategies,” he says. “At the same time, genetic testing could help identify candidates for clinical trials who are critical to discovering innovative new therapies to address conditions like elevated lipoprotein(a) and related cardiovascular disease risks.” Natarajan is director of Preventive Cardiology at MGH, assistant professor of Medicine at Harvard Medical School, and associate member of the Broad Institute of MIT and Harvard. Lead author Trinder is a visiting medical student from the Centre for Heart Lung Innovation, The University of British Columbia. Co-authors Mesbah Uddin, PhD, Krishna Aragam, MD, and Phoebe Finneran, BS, are members of the Program in Medical and Population Genetics and the Cardiovascular Disease Initiative at the Broad Institute and Preventive Cardiology at MGH. The study was supported by the biopharmaceutical company Amgen. About the Massachusetts General Hospital
1850
dbpedia
0
23
https://alextlc.org/condition/alsp-csf1r-related-leukoencephalopathy/
en
Adult onset leukoencephalopathy with axonal spheroids and pigmented glia/CSF1R related leukoencephalopathy
https://alextlc.org/wp-c…rns-1024x576.png
[ "https://www.facebook.com/tr?id=786507500067756&ev=PageView&noscript=1", "https://alextlc.org/wp-content/uploads/2022/09/logo-alex-tlc.svg", "https://alextlc.org/wp-content/uploads/2023/07/Inheritance-Patterns-1024x576.png", "https://alextlc.org/wp-content/uploads/2023/07/committed_small-300x145.png", "https://alextlc.org/wp-content/uploads/2023/07/BMA-Patient-information-awards_commended-300x213.jpg", "https://alextlc.org/wp-content/uploads/2022/10/fundraising-regulator-logo.svg" ]
[]
[]
[ "" ]
null
[]
2023-07-19T11:19:56+00:00
Description of the condition CSF1R related leukoencephalopathy is caused by mutations in the CSF1R gene. People usually begin experiencing symptoms in their 40’s-60’s although this may vary, even within families. Symptoms can be subtle in early stages, and many patients will first present to memory clinics, psychiatry (for mood changes), or movement clinics. It typically […]
en
https://alextlc.org/wp-c…2022/09/icon.svg
Alex - The Leukodystrophy Charity
https://alextlc.org/condition/alsp-csf1r-related-leukoencephalopathy/
Inheritance Autosomal dominant: In autosomal dominant conditions, only one copy of the genetic mutation is needed to cause the condition. We all have two copies of every gene, one from our mother and one from our father. Someone with an autosomal dominant condition has one parent with a copy of the genetic mutation and the condition themselves. Therefore, someone with an autosomal dominant condition has a genetic mutation on one copy of the gene from their parent with the condition. Each child of a parent with the genetic mutation will have a 50% chance of having the condition and a 50% chance of not having the condition. Genetic counselling Genetic counselling is essential for affected families due to the inheritance pattern of the condition. This is available at hospitals and Regional Genetic Centres. Please contact your doctor if you have any questions. Learn more about genetic testing and counselling here. Cause Caused by mutations in the CSF1R gene. This gene provides instructions to make the CSF-1 receptor protein which stimulates signalling pathways needed for cell growth, division and differentiation. Mutations prevent these signalling pathways from being stimulated, but it is not clear how this leads to white matter damage and cognitive difficulties.
1850
dbpedia
1
38
https://www.cdc.gov/heart-disease-family-history/about/about-lipoprotein-a.html
en
About Lipoprotein (a)
https://www.cdc.gov/hear…tein.jpg?_=98752
https://www.cdc.gov/hear…tein.jpg?_=98752
[ "https://www.cdc.gov/TemplatePackage/5.0/img/uswds/us_flag_small.png", "https://www.cdc.gov/TemplatePackage/5.0/img/uswds/icon-dot-gov.svg", "https://www.cdc.gov/TemplatePackage/5.0/img/uswds/icon-https.svg", "https://www.cdc.gov/TemplatePackage/5.0/img/logo/logo-notext.svg", "https://www.cdc.gov/TemplatePackage/5.0/img/logo/logo-notext.svg", "https://www.cdc.gov/heart-disease-family-history/media/images/lipoprotein.jpg", "https://www.cdc.gov/TemplatePackage/5.0/img/logo/cdc-logo-tag-right.svg" ]
[]
[]
[ "" ]
null
[]
2024-05-17T08:34:59-04:00
High levels of lipoprotein (a) increase the risk of heart attack, stroke, and aortic stenosis.
en
/TemplatePackage/5.0/img/favicon/apple-touch-icon.png
Heart Disease, Family Health History, and Familial Hypercholesterolemia
https://www.cdc.gov/heart-disease-family-history/about/about-lipoprotein-a.html
What it is High levels of lipoprotein (a) (Lp(a), pronounced “L-P-little-A”) increase your likelihood of having a heart attack, a stroke, and aortic stenosis, especially if you have familial hypercholesterolemia (FH) or signs of coronary heart disease. Cholesterol travels through the blood on lipoproteins, which are made of protein and fat. Lipoproteins include low-density lipoprotein (LDL), high-density lipoprotein (HDL), and Lp(a). Effects High Lp(a) levels increase your likelihood of having a heart attack or stroke, especially if you have FH or signs of coronary heart disease. This is because Like LDL-cholesterol, Lp(a)-cholesterol can build up in the walls of your blood vessels. The higher your Lp(a) level is, the more likely this is to happen. These cholesterol deposits, called plaques, can decrease blood flow to your heart, brain, kidneys, lungs, legs, and other parts of your body. Plaques can grow over time or suddenly rupture, blocking blood vessels and leading to heart attacks or strokes.1 Lp(a) can cause increased clotting, which can lead to rapidly formed blockages in blood vessels.1 Lp(a) promotes inflammation which increases the likelihood that plaques will rupture. Because of its role in inflammation, high Lp(a) can also lead to narrowing of the aortic valve, called aortic stenosis.1 Chronic inflammation leads to calcium build up on the valve, causing stiffness. This can result in reduced blood flow if the valve is unable to open completely. In some cases, people with aortic stenosis need surgery or a procedure to replace the aortic valve. Risk factors High Lp(a) levels run in families. If one of your family members has high Lp(a), talk to your healthcare provider about having your Lp(a) levels checked. Likewise, if you have high Lp(a), your healthcare provider may recommend that your children, siblings, or parents have their Lp(a) levels checked. How do I know if I have high Lp(a)? High Lp(a) levels, defined as greater than 50 mg/dL (125 nmol/L),2 are common. Median Lp(a) levels vary by race and sex.3 High Lp(a) is seen in people of all races and ethnicities but appears to be more common in Black people.3 Many people with high Lp(a) have no symptoms. However, your healthcare provider may suspect that you have high Lp(a) if you have any of the following risk factors: Poor circulation in your legs (called peripheral arterial disease) Heart attack, stroke, or coronary artery disease before age 55 (in men) or age 65 (in women) without known risk factors, such as high LDL, smoking, diabetes, or obesity Female family members who had a heart attack or stroke before age 65 Male family members who had a heart attack or stroke before age 55 Familial hypercholesterolemia Certain types of aortic stenosis Your healthcare provider can diagnose high Lp(a) by measuring your blood Lp(a) level and reviewing your personal and family health history. Lp(a) is not routinely included when you get your cholesterol checked. Your healthcare provider has to order the blood test for Lp(a) separately. About a third of people with FH also have high Lp(a) levels, and current recommendations state that people with FH should have their Lp(a) level checked. Treatment Lp(a) levels cannot be controlled by healthy eating and exercising. Lipoprotein apheresis is the only therapy approved by the Food and Drug Administration (FDA) for treating high Lp(a) levels, and it is only approved for people with FH who have LDL≥100 mg/dL, Lp(a)≥60 mg/dL, and coronary or other artery disease. Apheresis is a treatment like dialysis in which a machine removes Lp(a) and LDL-cholesterol from the blood. If you have high Lp(a) levels, you should take steps to lower your LDL-cholesterol if it is high. Some studies4 suggest that medications called statins might slightly raise Lp(a) levels but are still recommended due to their effects in lowering LDL-cholesterol and reducing the risk of heart attacks, strokes, and peripheral arterial disease. If you have FH, coronary artery disease, or peripheral arterial disease, your healthcare provider might recommend also taking a medication called PCSK9 inhibitors to further lower your LDL level. While a healthy lifestyle will not lower Lp(a) levels, it does impact LDL levels, so people with high Lp(a) should keep a healthy weight, not smoke, choose healthy foods and drinks, and get regular physical activity. Managing conditions such as diabetes and high blood pressure is also important for people with high Lp(a).
1850
dbpedia
0
8
https://www.huntershope.org/hdls/
en
ALSP
https://huntershope.wpen…00x300-45x45.jpg
https://huntershope.wpen…00x300-45x45.jpg
[ "https://huntershope.wpenginepowered.com/wp-content/themes/hunters-hope/images/logo.png", "https://huntershope.wpenginepowered.com/wp-content/themes/hunters-hope/images/logo.png 1x, https://huntershope.wpenginepowered.com/wp-content/themes/hunters-hope/images/logo2x.png 2x", "https://huntershope.wpenginepowered.com/wp-content/themes/hunters-hope/images/logo-rvrs.png", "https://huntershope.wpenginepowered.com/wp-content/themes/hunters-hope/images/logo-rvrs.png 1x, https://huntershope.wpenginepowered.com/wp-content/themes/hunters-hope/images/logo-rvrs2x.png 2x" ]
[]
[]
[ "" ]
null
[]
null
en
https://huntershope.wpen…00x300-45x45.jpg
https://www.huntershope.org/hdls/
What is ALSP or Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia? ALSP is a rare adult onset autosomal dominant disorder characterized by changes to certain parts of the brain. As the disorder name indicates, the individual will experience leukoencephalopathy, which is damage to the white matter of the brain, and damage to the axons which is caused by swellings called spheroids. This damage to the myelin and axons contributes to many of the neurological signs and symptoms seen in people with this condition. This condition is also known as Hereditary diffuse leukoencephalopathy with spheroids (HDLS), and CSF1R-related leukoencephalopathy. What Are the Symptoms? Personality changes Loss of social inhibitions and depression are some of the earliest symptoms of HDLS Memory loss Loss of impulse control, self-monitoring and focus Mild seizures Dementia Difficulty walking Movement abnormalities known as Parkinsonism: Unusually slow movement Trembling Muscle stiffness How Do You Get ALSP? This disorder is caused by mutations in the CSF1R gene. This gene provides instructions for making a protein called colony stimulating factor 1 receptor. This protein contributes to the growth of microglial cells. Further research is needed to determine how these gene mutations cause the symptoms. How Is ALSP Diagnosed? It is diagnosed through evaluation of the symptoms the individual is experiencing, genetic testing, and MRI. Diagnosis is confirmed by identification of a heterozygous pathogenic variant in the CSF1R gene. Is There a Treatment? Bone marrow transplant is a potential treatment for ALSP for eligible patients. There may also be clinical trials for potential new therapies listed on clinicaltrials.gov. Helpful Resources ALSP Info Sisters’ Hope Foundation NORD Genetics Home Reference Gene Reviews
1850
dbpedia
1
14
https://www.webmd.com/cholesterol-management/hdl-cholesterol-the-good-cholesterol
en
Density Lipoprotein): Overview, Safe Levels
https://img.lb.wbmdstati…erol_bigbead.jpg
https://img.lb.wbmdstati…erol_bigbead.jpg
[ "https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/logos/webmd/web/webmd_logo_white.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/library_books.2bf509db.svg", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/articles/biographies/sachdev_poonam_382x382.jpg?resize=51px:51px&output-quality=75", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/BigBead/hdl_cholesterol_bigbead/1800x1200_hdl_cholesterol_bigbead.jpg?resize=750:*", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/more_on/MoreOn_Allergies.jpg?resize=300px:*&output-quality=75", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/cholesterol_hpt_toc_redesign/cholesterol_guide_chapter_4_849177432.jpg?resize=500px:*&output-quality=75", "https://privacy-policy.truste.com/privacy-seal/seal?rid=07326333-3522-463d-81bf-f00fd7171fff", "https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/layout/shared/tag-registered.png?resize=*:60px", "https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/oncology/1/footer-images/ad-choice.png", "https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/oncology/1/images/webmd-logo-white.svg", "https://sb/p?c1=2&c2=6035829&cv=3.9.1&cj=1" ]
[]
[]
[ "" ]
null
[ "Hope Winsborough Matthew Hoffman", "MD Amy Gopal", "www.facebook.com" ]
2008-08-24T20:00:00
HDL (high-density lipoprotein), also known as good cholesterol, reduces the risk of heart diseases. Here's how.
en
https://img.lb.wbmdstati…icon/favicon.png
WebMD
https://www.webmd.com/cholesterol-management/hdl-cholesterol-the-good-cholesterol
What Is HDL Cholesterol? HDL is short for high-density lipoprotein. Each bit of HDL cholesterol is a microscopic blob that consists of a rim of lipoprotein surrounding a cholesterol center. The HDL cholesterol particle is dense compared to other types of cholesterol particles, so it's called high-density. HDL cholesterol is the well-behaved "good cholesterol." This friendly scavenger cruises your bloodstream. As it does, it removes harmful bad cholesterol from where it doesn't belong. High HDL levels reduce your risk for heart disease--but low levels increase the risk. Why Is HDL Cholesterol Good? Cholesterol isn't all bad. In fact, cholesterol is an essential fat. It provides stability in every cell of your body. To travel through your bloodstream, cholesterol has to be transported by helper molecules called lipoproteins. Each lipoprotein has its own preferences for cholesterol, and each acts differently with the cholesterol it carries. Experts believe HDL cholesterol may act in a variety of helpful ways that tend to reduce your risk for heart disease: HDL cholesterol scavenges and removes low-density lipoprotein (LDL) -- or "bad" -- cholesterol. HDL reduces, reuses, and recycles LDL cholesterol by transporting it to the liver where it can be reprocessed. HDL cholesterol acts as a maintenance crew for the inner walls (endothelium) of blood vessels. Damage to the inner walls is the first step in the process of atherosclerosis, which causes heart attacks and strokes. HDL scrubs the wall clean and keeps it healthy. HDL vs. LDL High-density lipoprotein, or HDL, carries cholesterol to your liver. There it gets removed before it has a chance to build up in your arteries. Low-density lipoprotein, or LDL, transports cholesterol directly to your arteries. This can result in a plaque buildup--called atherosclerosis--that can lead to heart attack and stroke. HDL Cholesterol Levels A cholesterol test or lipid panel shows your level of HDL cholesterol. What do the numbers mean? In general, people with high HDL are at lower risk for heart disease. People with low HDL are at higher risk. A lipid panel typically measures five different types of lipids, or fat molecules, in your blood. Measurements are given in milligrams per deciliter (mg/dL): Total cholesterol: Your overall cholesterol level, which is a combination of low-density lipoprotein (LDL), high-density lipoprotein (HDL), and very low-density lipoprotein (VLDL) Low-density lipoprotein (LDL): A type of cholesterol that can collect in your blood vessels, increasing the risk of heart disease; also known as "bad cholesterol" High-density lipoprotein (HDL): A type of cholesterol that helps to decrease buildup of LDL in the blood vessels; also known as "good cholesterol" Very low-density lipoprotein (VLDL): Like LDL, it's also a "bad" form of cholesterol. If you fasted before your lipid panel test, higher-than-normal amounts of VLDL cholesterol are associated with abnormal lipid metabolism. Triglycerides: A type of fat that comes from the foods we eat. Higher amounts of triglycerides are associated with heart disease and inflammation of the pancreas. Optimal HDL Levels The higher your HDL number, the better. The optimal level of HDL to protect you from heart disease is 60 mg/dL or above. However, high levels don't protect you from the negative impact of high LDL. Normal HDL Levels Recommended HDL cholesterol levels vary based on sex: For men and those assigned male at birth (AMAB), HDL levels should be 40 mg/dL or higher to lower the risk of heart disease. For women and those assigned female at birth (AFAB), HDL should be 50 mg/dL or higher to lower the risk. For children ages 2-19, an HDL level of 45 mg/dL or above is considered to be normal. Low HDL Levels Your HDL cholesterol is considered low in these ranges: Men/AMAB: Less than 40 mg/dL Women/AFAB: Less than 50 mg/dL  In general, low levels of HDL can contribute to having a higher level of LDL. That's because HDL cholesterol helps your body get rid of LDL -- the "bad" cholesterol. It moves LDL away from arteries and toward the liver, which eliminates the LDL from your body. If you don't have enough HDL helping to reduce your LDL level, it doesn't lower your risk of heart disease, heart attack, and stroke. There are several causes of low HDL, including: Tangier disease: This genetic condition (inherited from parents) causes low levels of HDL cholesterol. Familial combined hyperlipidemia: People with this inherited condition (passed on from one or both parents) have trouble processing cholesterol. That means HDL cholesterol can be too low and LDL can be too high. Metabolic syndrome: If you have metabolic syndrome, low HDL may be part of it. Multiple health conditions combine in this syndrome and increase risk of heart disease, Type 2 diabetes, and stroke. Overweight/obesity: If you have extra weight, or a body mass index (BMI) higher than 25, your HDL cholesterol is likely to be lower. In addition, lower levels of HDL cholesterol are associated with obesity, especially fat around the abdomen.  Smoking or tobacco use: The nicotine in tobacco lowers your HDL. All tobacco products include nicotine, including e-cigarettes. Medication: Certain medicines may lower HDL levels, such as beta blockers, some diuretics, and others. High HDL Levels For adults, anything above 80 mg/dL is considered high. An abnormally high level of HDL can cause problems, too. In some cases, it may speed up atherosclerosis--the buildup of fats on the artery walls. High HDL cholesterol could be caused by: Genetic mutations: Some changes in your genetic makeup can cause your body to produce too much HDL or have trouble removing it. Primary biliary cholangitis: This disease makes it hard for bile (a fluid your liver makes) to pass through your digestive system. Your body can't break down fats, which can cause high blood cholesterol. Alcohol use disorder: Alcohol consumption is known to raise "good" cholesterol levels. But more isn't necessarily better. Some studies indicate that the increases in HDL from alcohol don't provide any benefit. Drinking also increases your risk of heart disease, stroke, and liver disease.  Medications: Some medicines that help lower LDL cholesterol, such as statins, may also raise HDL cholesterol levels to abnormally high levels.  How to Raise HDL Cholesterol If your HDL is low, you can take several steps to boost your HDL level and reduce your heart disease risk: Exercise. Aerobic exercise for 30 to 60 minutes on most days of the week can help pump up HDL. Quit smoking. Tobacco smoke lowers HDL, and quitting can increase HDL levels. Keep a healthy weight. Besides improving HDL levels, avoiding obesity reduces risk for heart disease and multiple other health conditions. Eat a Mediterranean diet. It has repeatedly been shown to raise HDL levels. The Mediterranean diet consists of healthy fats (mainly olive oil), vegetables, fruits, and whole grains. Limit alcoholic beverages. If you're drinking alcohol, keep your intake to: One drink per day for all women, or for men older than 65 Up to two drinks a day for men 65 and younger In certain cases, your doctor may recommend medication to improve your cholesterol level. Remember that multiple factors besides cholesterol contribute to heart disease. Diabetes, smoking, high blood pressure, obesity, and genetics are all important as well. Because so many factors contribute to heart disease, cholesterol isn't everything. People with normal HDL cholesterol can have heart disease. And people with low HDL levels can have healthy hearts. Overall, though, people who have low HDL cholesterol will have a greater risk of developing heart disease than people with high HDL levels. Experts recommend follow-up cholesterol testing every five years for most people. People with abnormal lipid panels, or who have other risk factors, may need more frequent cholesterol tests. If you have high cholesterol or low HDL levels, take steps to increase HDL cholesterol such as eating right, exercising regularly, and not smoking. Lifestyle changes can make a big difference for most people and may prevent heart disease and stroke. Takeaways The "good" cholesterol, HDL, is important because it's involved in clearing "bad" cholesterol (LDL) from your body. Low levels of HDL can increase your risk of heart disease, heart attack, and stroke. Certain health conditions can lower HDL levels. Lifestyle changes and specific treatment plans can boost your HDL cholesterol to support your overall health. HDL Cholesterol FAQs What is a good level of HDL? For men and those assigned male at birth (AMAB), HDL levels should be 40 mg/dL or higher to lower the risk of heart disease. For women and those assigned female at birth (AFAB), HDL should be 50 mg/dL or higher to lower the risk. The optimal level of HDL to protect you from heart disease is 60 mg/dL or above. Is HDL cholesterol good or bad cholesterol? High-density lipoprotein, or HDL, is considered to be "good" because it carries cholesterol to your liver, where it gets removed before it has a chance to build up in your arteries.  What is a healthy HDL level by age? People 19 and younger: More than 45 mg/dL Men/AMAB 20 and older: More than 40 ml/dL Women/AFAB 20 and older: More than 50 mg/dL How do I raise my HDL? Lifestyle changes can make a difference. Here are some ways to help raise your HDL cholesterol: Exercise for 30-60 minutes most days Quit smoking Avoid obesity by maintaining a healthy weight Eat a Mediterranean diet Drink alcohol in moderation Work with your doctor to address any medical conditions and make any necessary changes in medication to help improve your HDL level. Â
1850
dbpedia
1
1
https://medlineplus.gov/genetics/condition/familial-hdl-deficiency/
en
Familial HDL deficiency: MedlinePlus Genetics
https://medlineplus.gov/…dition_Share.jpg
https://medlineplus.gov/…dition_Share.jpg
[ "https://medlineplus.gov/uswds/img/us_flag_small.png", "https://medlineplus.gov/uswds/img/icon-dot-gov.svg", "https://medlineplus.gov/uswds/img/icon-https.svg", "https://medlineplus.gov/images/nihlogo.png", "https://medlineplus.gov/images/m_logo_25.png", "https://medlineplus.gov/css/img/icon_camera_small.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/PX00012W_PRESENTATION.jpeg", "https://medlineplus.gov/images/feed.png", "https://medlineplus.gov/images/i_share_twitter.png", "https://medlineplus.gov/images/i_share_fb.png", "https://medlineplus.gov/images/Instagram_Glyph_Gradient_RGB.png", "https://medlineplus.gov/images/i_social_media_toolkit.png", "https://medlineplus.gov/images/return-top.png" ]
[]
[]
[ "" ]
null
[]
null
Familial HDL deficiency is a condition characterized by low levels of high-density lipoprotei% (HDL) in the blood. Explore symptoms, inheritance, genetics of this condition.
en
https://medlineplus.gov/images/favicon.ico
https://medlineplus.gov/genetics/condition/familial-hdl-deficiency/
Familial HDL deficiency is a condition characterized by low levels of high-density lipoprotei% (HDL) in the blood. HDL is a molecule that transports cholesterol and certain fats called phospholipids through the bloodstream from the body's tissues to the liver. Once in the liver, cholesterol and phospholipids are redistributed to other tissues or removed from the body. HDL is often referred to as "good cholesterol" because high levels of this substance reduce the chances of developing heart and blood vessel (cardiovascular) disease. People with familial HDL deficiency may develop cardiovascular disease at a relatively young age, often before age 50. Severely reduced levels of HDL in the blood is a characteristic feature of a related disorder called Tangier disease. People with Tangier disease have additional signs and symptoms, such as disturbances in nerve function; enlarged, orange-colored tonsils; and clouding of the clear covering of the eye (corneal clouding). However, people with familial HDL deficiency do not have these additional features. Mutations in the ABCA1 gene or the APOA1 gene cause familial HDL deficiency. The proteins produced from these genes work together to remove cholesterol and phospholipids from cells. The ABCA1 gene provides instructions for making a protein that removes cholesterol and phospholipids from cells by moving them across the cell membrane. The movement of these substances across the membrane is enhanced by another protein called apolipoprotein A-I (apoA-I), which is produced by the APOA1 gene. Once outside the cell, the cholesterol and phospholipids combine with apoA-I to form HDL. ApoA-I also triggers a reaction that converts cholesterol to a form that can be fully integrated into HDL and transported through the bloodstream. ABCA1 gene mutations and some APOA1 gene mutations prevent the release of cholesterol and phospholipids from cells. Other mutations in the APOA1 gene reduce the protein's ability to stimulate the conversion of cholesterol. These ABCA1 and APOA1 gene mutations decrease the amount of cholesterol or phospholipids available to form HDL, resulting in low levels of HDL in the blood. A shortage (deficiency) of HDL is believed to increase the risk of cardiovascular disease.
1850
dbpedia
0
19
https://mayoclinic.elsevierpure.com/en/publications/leukoencephalopathy-with-spheroids-hdls-and-pigmentary-leukodystr
en
Leukoencephalopathy with spheroids (HDLS) and pigmentary leukodystrophy (POLD): A single entity?
https://mayoclinic.elsevierpure.com/skin/headerImage/
https://mayoclinic.elsevierpure.com/skin/headerImage/
[ "https://mayoclinic.elsevierpure.com/skin/headerImage/" ]
[]
[]
[ "" ]
null
[ "C. Wider", "J. A. Van Gerpen", "S. Dearmond", "E. A. Shuster", "D. W. Dickson", "Z. K. Wszolek" ]
null
en
Mayo Clinic
https://mayoclinic.elsevierpure.com/en/publications/leukoencephalopathy-with-spheroids-hdls-and-pigmentary-leukodystr
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) present as adult-onset dementia with motor impairment and epilepsy. They are regarded as distinct diseases. We review data from the literature that support their being a single entity. Apart from a slightly older age at onset, a more rapid course, and more prominent pyramidal tract involvement, familial POLD is clinically similar to HDLS. Moreover, the pathologic hallmarks of the two diseases, axonal spheroids in HDLS and pigmented macrophages in POLD, can be identified in both conditions. This supports HDLS and POLD being referred collectively as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP). TY - JOUR T1 - Leukoencephalopathy with spheroids (HDLS) and pigmentary leukodystrophy (POLD) T2 - A single entity? AU - Wider, C. AU - Van Gerpen, J. A. AU - Dearmond, S. AU - Shuster, E. A. AU - Dickson, D. W. AU - Wszolek, Z. K. PY - 2009/6/2 Y1 - 2009/6/2 N2 - Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) present as adult-onset dementia with motor impairment and epilepsy. They are regarded as distinct diseases. We review data from the literature that support their being a single entity. Apart from a slightly older age at onset, a more rapid course, and more prominent pyramidal tract involvement, familial POLD is clinically similar to HDLS. Moreover, the pathologic hallmarks of the two diseases, axonal spheroids in HDLS and pigmented macrophages in POLD, can be identified in both conditions. This supports HDLS and POLD being referred collectively as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP). AB - Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) present as adult-onset dementia with motor impairment and epilepsy. They are regarded as distinct diseases. We review data from the literature that support their being a single entity. Apart from a slightly older age at onset, a more rapid course, and more prominent pyramidal tract involvement, familial POLD is clinically similar to HDLS. Moreover, the pathologic hallmarks of the two diseases, axonal spheroids in HDLS and pigmented macrophages in POLD, can be identified in both conditions. This supports HDLS and POLD being referred collectively as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP). UR - http://www.scopus.com/inward/record.url?scp=67650066957&partnerID=8YFLogxK UR - http://www.scopus.com/inward/citedby.url?scp=67650066957&partnerID=8YFLogxK U2 - 10.1212/WNL.0b013e3181a826c0 DO - 10.1212/WNL.0b013e3181a826c0 M3 - Review article C2 - 19487654 AN - SCOPUS:67650066957 SN - 0028-3878 VL - 72 SP - 1953 EP - 1959 JO - Neurology JF - Neurology IS - 22 ER -
1850
dbpedia
2
77
https://en.wikipedia.org/wiki/3D_cell_culture
en
3D cell culture
https://en.wikipedia.org/static/favicon/wikipedia.ico
https://en.wikipedia.org/static/favicon/wikipedia.ico
[ "https://en.wikipedia.org/static/images/icons/wikipedia.png", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-wordmark-en.svg", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-tagline-en.svg", "https://upload.wikimedia.org/wikipedia/commons/thumb/7/7e/3d_cell_culture_%281%29.svg/220px-3d_cell_culture_%281%29.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/a/a1/Electron_microscopy_%28Ho%29.tif/lossy-page1-220px-Electron_microscopy_%28Ho%29.tif.jpg", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://en.wikipedia.org/static/images/footer/wikimedia-button.svg", "https://en.wikipedia.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[ "Contributors to Wikimedia projects" ]
2013-07-08T21:36:28+00:00
en
/static/apple-touch/wikipedia.png
https://en.wikipedia.org/wiki/3D_cell_culture
Free-floating three-dimensional culture of cells A 3D cell culture is an artificially created environment in which biological cells are permitted to grow or interact with their surroundings in all three dimensions. Unlike 2D environments (e.g. a Petri dish), a 3D cell culture allows cells in vitro to grow in all directions, similar to how they would in vivo.[1] These three-dimensional cultures are usually grown in bioreactors, small capsules in which the cells can grow into spheroids, or 3D cell colonies. Approximately 300 spheroids are usually cultured per bioreactor.[1] Background [edit] 3D cell cultures have been used in research for several decades.[2] One of the first recorded approaches for their development was at the beginning of the 20th century, with the efforts of Alexis Carrel to develop methods for prolonged in vitro tissue cultures.[3] Early studies in the 80's, led by Mina Bissell from the Lawrence Berkeley National Laboratory, highlighted the importance of 3D techniques for creating accurate in vitro culturing models. This work focused on the importance of the extracellular matrix and the ability of cultures in artificial 3D matrices to produce physiologically relevant multicellular structures, such as acinar structures in healthy and cancerous breast tissue models. These techniques have been applied to in vitro disease models used to evaluate cellular responses to pharmaceutical compounds.[4] Eric Simon, in a 1988 NIH SBIR grant report, showed that electrospinning could be used to produce nano- and submicron-scale polystyrene and polycarbonate fibrous mats (now known as scaffolds) specifically intended for use as in vitro cell substrates. This early use of electrospun fibrous lattices for cell culture and tissue engineering showed that various cell types including Human Foreskin Fibroblasts (HFF), transformed Human Carcinoma (HEp-2), and Mink Lung Epithelium (MLE) would adhere to and proliferate upon the fibers. It was noted that as opposed to the flattened morphology typically seen in 2D culture, cells grown on the electrospun fibers exhibited a more histotypic rounded 3-dimensional morphology generally observed in vivo.[5] 3D cell culture, by emulating essential aspects of the in vivo environment, including interactions between cells and the extracellular matrix, allows for the faithful recreation of structural architecture and specialized functions in normal tissues or tumors in a laboratory setting. This approach authentically models the conditions and processes of living tissues, producing responses akin to those observed in vivo. Since its inception in the 1970s, 3D cell culture has provided significant insights into the mechanisms regulating tissue homeostasis and cancer.[6] Moreover, it has expedited translational research in the realms of cancer biology and tissue engineering.[7] Properties [edit] In living tissue, cells exist in 3D microenvironments with intricate cell-cell and cell-matrix interactions and complex transport dynamics for nutrients and cells.[8][9][10][11][12][13][14][15][16] Standard 2D, or monolayer, cell cultures are inadequate representations of this environment, which often makes them unreliable predictors of in vivo drug efficacy and toxicity.[17][14] 3D spheroids more closely resemble in vivo tissue in terms of cellular communication and the development of extracellular matrices.[1] These matrices help the cells to be able to move within their spheroid similar to the way cells would move in living tissue.[10] The spheroids are thus improved models for cell migration, differentiation, survival, and growth.[15] Furthermore, 3D cell cultures provide more accurate depiction of cell polarization, since in 2D, the cells can only be partially polarized.[10] Moreover, cells grown in 3D exhibit different gene expression than those grown in 2D.[10] The third dimension of cell growth provides more contact space for mechanical inputs and for cell adhesion, which is necessary for integrin ligation, cell contraction and even intracellular signalling.[18][19] Normal solute diffusion and binding to effector proteins (like growth factors and enzymes) is also reliant on the 3D cellular matrix, so it is critical for the establishment of tissue scale solute concentration gradients[20][21] For the purposes of drug toxicology screening, it is much more useful to test gene expression of in vitro cells grown in 3D than 2D, since the gene expression of the 3D spheroids will more closely resemble gene expression in vivo. Lastly, 3D cell cultures have greater stability and longer lifespans than cell cultures in 2D.[22] This means that they are more suitable for long-term studies and for demonstrating long-term effects of the drug. 3D environments also allow the cells to grow undisturbed. In 2D, the cells must undergo regular trypsinization to provide them with sufficient nutrients for normal cell growth.[23] 3D spheroids have been cultured in a lab setting for up to 302 days while still maintaining healthy, non-cancerous growth.[22] In the interdisciplinary research of biology and aerospace, the 3D printed-scaffolds are also being used for protecting cells from the effect of gravity during the launching.[24] Classification of 3D culture methods [edit] There are a large number of commercially available culturing tools that claim to provide the advantages of 3D cell culture. In general, the platforms can be classified in two types of 3D culturing methods: scaffold techniques and scaffold-free techniques. Scaffold techniques [edit] Scaffold techniques include the use of solid scaffolds, hydrogels and other materials. In a recent study potentiality of human CD34+ stem cells explored by generating in vitro agarose gel 3D model to understand the bone ossification process.[25] Scaffolds can be used to generate microtissue 3D model by culturing fibroblasts outside of tumour cells, mimicking the tumor stroma interaction.[26] The effectiveness of scaffolds in various applications, particularly in tissue engineering, is significantly impacted by factors such as pore distribution, exposed surface area, and porosity. The quantity and arrangement of these elements influence both the depth and rate at which cells penetrate the scaffold volume, the structure of the resulting extracellular matrix, and ultimately, the success of the regenerative process.[27] Scaffolds can be produced with diverse architectures depending on the manufacturing method, leading to either random or precisely designed pore distribution.[28] Recently, advanced computer-controlled rapid prototyping techniques have been employed to create scaffolds with well-organized geometries.[29] Hydrogels [edit] As the natural extracellular matrix (ECM) is important in the survival, proliferation, differentiation and migration of the cells, different hydrogel matrices mimicking natural ECM structure are considered as potential approaches towards in vivo –like cell culturing.[30][31][32] Hydrogels are composed of interconnected pores with high water retention, which enables efficient transport of e.g. nutrients and gases. Several different types of hydrogels from natural and synthetic materials are available for 3D cell culture, including e.g. animal ECM extract hydrogels, protein hydrogels, peptide hydrogels, polymer hydrogels, and wood-based nanocellulose hydrogel. The approach to crafting the optimal ECM replica relies on the specific characteristics of the culture in question and typically involves employing diverse and independent chemical processes.[33] For example, the utilization of photolabile chemistries can lead to the erosion of specific regions within a gel, and subsequently exposing these areas allows for the application of adhesive ligands, promoting cell adhesion and migration.[34] The development of more intricate frameworks is anticipated, comprising interwoven networks of chemistries under the control of both cells and users. In essence, there is no singular network capable of faithfully emulating the intricate ECM of every tissue type. However, a thoughtful integration of bioinspired cues into synthetic gels holds the potential to yield resilient and versatile scaffolds applicable across various cell culture systems.[35] Scaffold-free techniques [edit] Scaffold free techniques employ another approach independent from the use scaffold. Scaffold-free methods include e.g. the use of low adhesion plates, hanging drop plates, micropatterned surfaces, and rotating bioreactors, magnetic levitation, and magnetic 3D bioprinting. Spheroids [edit] Spheroids are a type of three-dimensional cell modeling that better simulate a live cell's environmental conditions compared to a two-dimensional cell model, specifically with the reactions between cells and the reactions between cells and the matrix.[37] Spheroids are useful in the study of changing physiological characteristics of cells,[38] the difference in the structure of healthy cells and tumor cells, and the changes cells undergo when forming a tumor.[39] Spheroids co-cultured with tumor and healthy cells were used to simulate how cancerous cells interact with normal cells.[40] Spheroids can also be co-cultured with fibroblasts to mimic tumor-stroma interaction.[41] Spheroids can be grown with a few different methods. One common method is to use low cell adhesion plates, typically a 96 well plate, to mass-produce spheroid cultures, where the aggregates form in the rounded bottom of the cell plates.[36][42] Spheroids can also be cultured using the hanging drop method[43] involving forming cell aggregates in drops that hang from the surface of a cell plate.[37] Other methods under investigation include the use of rotating wall vessel bioreactors, which spins and cultures the cells when they are constantly in free fall and forms aggregates in layers[44] Recently, some protocols have been standardized to produce uniform and reliable spheroids.[45] Researchers had also explored standardized, economical and reproducible methods for 3D cell culture.[46] To improve reproducibility and transparency in spheroid experiments, an international consortium developed MISpheroID (Minimal Information in Spheroid Identity).[47] Clusteroids [edit] clusteroids are a type of three-dimensional cell modeling similar to spheroids but are distinguished by their creation method; grown as clusters of cells in an aqueous two-phase system of water-in-water Pickering emulsion using interfacial tension and osmotic shrinkage to pack the cells into dense clusters which are then cultured in a hydrogel into tissues or organoids.[48][49] In the absence of blood vessels, oxygen permeability is impaired during necrotic nucleus formation and this prevents the ex vivo use of 3D cell culture. There is an emulsion template that can overcome this problem. This approach allowed researchers to adjust the cell composition to attain the ideal conditions for promoting the synthesis of diverse angiogenic protein markers within the co-cultured clusteroids.[49] HUVEC cells exhibit a reaction to the presence of Hep-G2 cells and their derivatives by generating endothelial cell sprouts in Matrigel, all without the external introduction of vascular endothelial growth factor (VEGF) or other agents that induce angiogenesis.[50][51] The replication of this cultivation technique is straightforward for generating various cell co-culture spheroids.[52] The w/w Pickering emulsion template greatly aids in constructing 3D co-culture models, offering significant potential for applications in drug testing and tissue engineering.[53] Bioreactors [edit] The bioreactors used for 3D cell cultures are small plastic cylindrical chambers that are specifically engineered for the purpose of growing cells in three dimensions. The bioreactor uses bioactive synthetic materials such as polyethylene terephthalate membranes to surround the spheroid cells in an environment that maintains high levels of nutrients.[54][55] They are easy to open and close, so that cell spheroids can be removed for testing, yet the chamber is able to maintain 100% humidity throughout.[1] This humidity is important to achieve maximum cell growth and function. The bioreactor chamber is part of a larger device that rotates to ensure equal cell growth in each direction across three dimensions.[1] MC2 Biotek has developed a bioreactor to incubate proto-tissue that uses gas exchange to maintain high oxygen levels within the cell chamber.[56] This is an improvement over previous bioreactors because the higher oxygen levels help the cell grow and undergo normal cell respiration.[15] Collaborative efforts between tissue engineering (TE) firms, academic institutions, and industrial partners can enhance the transformation of research-oriented bioreactors into efficient commercial manufacturing systems.[57] Academic collaborators contribute foundational aspects, while industrial partners provide essential automation elements, ensuring compliance with regulatory standards and user-friendliness.[58] Established consortia in Europe, such as REMEDI, AUTOBONE, and STEPS, focus on developing automated systems to streamline the engineering of autologous cell-based grafts.[59] The aim is to meet regulatory criteria and ensure cost-effectiveness, making tissue-engineered products more clinically accessible and advancing the translational paradigm of TE from research to a competitive commercial field.[60] Microfluidics [edit] The utilization of microfluidic technology facilitates the generation of intricate micro-scale structures and the precise manipulation of parameters, thereby emulating the in vivo cellular milieu. The integration of microfluidic technology with 3D cell culture holds considerable potential for applications that seek to replicate in vivo tissue characteristics, notably exemplified by the evolving organ-on-a-chip system.[61] The various cell structures in the human body must be vascularized to receive the nutrients and gas exchange in order to survive. Similarly, 3D cell cultures in vitro require certain levels of fluid circulation, which can be problematic for dense, 3D cultures where cells may not all have adequate exposure to nutrients. This is particularly important in hepatocyte cultures because the liver is a highly vascularized organ. One study cultured hepatocytes and vascular cells together on a collagen gel scaffold between microfluidic channels, and compared growth of cells in static and flowing environments, and showed the need for models with tissues and a microvascular network.[62] Another study showed that hanging-drop based spheroid co-culture device can be useful, generating two different cell spheroids on adjacent channels of microfluidic hanging drop device, and co-culturing spheroids with merging droplets, to monitor tumor-induced angiogenesis.[63] Microfluidic 3D cell culture, with its potential applications in biomedical research and tissue engineering, is an area of growing interest. However, its advancement is accompanied by several formidable challenges.[64] One such challenge pertains to the difficulty in accessing cultured cells within microsystems, coupled with the intricate nature of sample extraction for subsequent assays.[65] Additionally, the development of methodologies and devices dedicated to in vivo-like cell metabolism and functions study, as well as drug discovery, represents a significant hurdle for microfluidic 3D cell culture devices.[66] Another noteworthy impediment is the limited availability of microfabrication instrumentation in conventional biology laboratories. Moreover, the commercialization of mature and user-friendly microfluidic devices poses a substantial challenge, hindering their accessibility to biologists.[67] Lastly, while biologists often seek high-throughput assay tools with optimal reproducibility, microfluidics encounters technical limitations in meeting these demands, despite the potential feasibility of parallel assays.[68] High-throughput screening [edit] Advanced development of 3D models for high-throughput screening in high density formats has recently been achievable due to technological achievements related to increased microplate density. These can be found in 384 and 1536-well formats that are cell repellent, cost effective, and amenable to fully automated screening platforms.[69] Two options that afford 1536-well formats are available from either Greiner Bio-One using the m3D Magnetic 3D bioprinting[70] and Corning Life Sciences which incorporates an ultra-low attachment surface coating, along with a microcavity geometry and gravity to create 3D models.[71][72] Due to the rapid and affordable methods and technologies that have been developed for 3D screening, parallel high-throughput screening approaches to test isogenic pairs of oncogene related mutants versus wildtype have been enabled.[73] Moreover, High-throughput screening techniques play a pivotal role in connecting the realms of pharmacology and toxicology within the framework of 3D cell culture. Pharmacology and toxicology [edit] A primary purpose of growing cells in 3D scaffolds and as 3D cell spheroids in vitro is to test pharmacokinetic and pharmacodynamic effects of drugs and nanomaterials in preclinical trials.[15][74][75][76][77] Toxicology studies have shown 3D cell cultures to be nearly on par with in vivo studies for the purposes of testing toxicity of drug compounds. When comparing LD50 values for 6 common drugs: acetaminophen, amiodarone, diclofenac, metformin, phenformin, and valproic acid, the 3D spheroid values correlated directly with those from in vivo studies.[78] Although 2D cell cultures have previously been used to test for toxicity along with in vivo studies, the 3D spheroids are better at testing chronic exposure toxicity because of their longer life spans.[79] The matrix in 3D Spheroids causes cells to maintain actin filaments and is more relevant physiologically in cytoskeletal organization and cell polarity and shape of human cells.[80] The three-dimensional arrangement allows the cultures to provide a model that more accurately resembles human tissue in vivo without using animal test subjects.[81] The current protocols for evaluating drug candidates and assessing toxicity heavily depend on outcomes derived from early-stage in vitro cell-based assays, with the expectation that these assays faithfully capture critical aspects of in vivo pharmacology and toxicology.[82] Various in vitro designs have been fine-tuned for high throughput to enhance screening efficiency, allowing exhaustive libraries of potential pharmacologically relevant or potentially toxic molecules to undergo scrutiny for cell signals indicative of tissue damage or aligned with therapeutic objectives.[83] Innovative approaches to multiplexed cell-based assay designs, involving the selection of specific cell types, signaling pathways, and reporters, have become standard practice.[84] Despite these advancements, a considerable percentage of new chemical and biological entities (NCEs/NBEs) encounter setbacks in late-stage human drug testing. Some receive regulatory "black box" warnings, while others are withdrawn from the market due to safety concerns post-regulatory approval.[85] This recurrent pattern underscores the inadequacy of in vitro cell-based assays and subsequent preclinical in vivo studies in furnishing comprehensive pharmacological and toxicity data or reliable predictive capacity for comprehending the in vivo performance of drug candidates.[86] The absence of a dependable translational assay toolkit for pharmacology and toxicology contributes to the high cost and inefficiency of transitioning from initial in vitro cell-based screens to in vivo testing and subsequent clinical approvals.[87] Particular emphasis is placed on their capacity to retain essential cell and molecular interactions, as well as physiological parameters influencing cell phenotypes and responses to bioactive agents. The distinctive advantages and challenges associated with these models are scrutinized, with a specific focus on their suitability for cell-based assays and their predictive capabilities, crucial for establishing accurate correlations with in vivo mechanisms of drug toxicity.[88] While assessing safety and efficacy, these models are well equipped to model a wide range of disease states. Each of these models has advantages and limitations that require model development and data interpretation. Public-private partnerships are critical to advance and stimulate research in this area.[89] Criticisms [edit] Existing 3D methods are not without limitations, including scalability, reproducibility, sensitivity, and compatibility with high-throughput screening (HTS) instruments. Cell-based HTS relies on rapid determination of cellular response to drug interaction, such as dose dependent cell viability, cell-cell/cell-matrix interaction, and/or cell migration, but the available assays are not optimized for 3D cell culturing. Another challenge faced by 3D cell culturing is the limited amount of data and publications that address mechanisms and correlations of drug interaction, cell differentiation, and cell-signalling in these 3D environments. None of the 3D methods have yet replaced 2D culturing on a large scale, including in the drug development process; although the number of 3D cell culturing publications is increasing rapidly, the current limited biochemical characterization of 3D tissue diminishes the adoption of new methods. Drug-induced liver injury (DILI) stands as a primary cause of compound attrition in the pharmaceutical realm during the course of drug development.[90] To preemptively assess the toxicity of compounds before embarking on laboratory animal testing, a range of in-vitro cell culture toxicity assays has been employed over the years.[91] While two-dimensional (2D) in-vitro cell culture models are commonly utilized and have contributed significantly to our understanding, they frequently exhibit limitations in faithfully replicating the natural structures of in-vivo tissues.[92] Although the most logical testing method involves humans, ethical constraints associated with human trials pose significant challenges.[93] Consequently, there is a pressing need for enhanced human-relevant and predictive models to overcome these limitations.[94] The past decade has witnessed substantial endeavors aimed at advancing three-dimensional (3D) in-vitro cell culture models to better emulate in-vivo physiological conditions. The intrinsic advantages of 3D cell culture lie in its ability to represent cellular interactions akin to those in-vivo. When appropriately validated, 3D cell culture models can serve as a pivotal intermediary, bridging the gap between conventional 2D cell culture models and in-vivo animal models. This review endeavors to offer a comprehensive overview of the challenges associated with the sensitivity of biomarkers employed in detecting DILI during drug development.[95] Additionally, it explores the potential of 3D cell culture models to address the existing gaps in the current paradigm, offering a promising avenue for more accurate toxicity assessments.[96] There are also problems using spheroids as a model for cancerous tissue. Although beneficial for 3D tissue culture, tumor spheroids have been criticized for being challenging or impossible to "manipulate gradients of soluble molecules in [3D spheroid] constructs, and to characterize cells in these complex gradients", unlike the paper-supported 3D cell culture for tissue-based bioassays explored by Ratmir et al.[55] Further challenges associated with complex 3D cell culture techniques include: imaging due to large scaffold sizes and incompatibility with many fluorescence microscopes, flow cytometry because it requires the dissociation of spheroids into a single-cell suspension, and the automation of liquid handling.[97] 2D models cannot study cell-cell and cell-matrix interactions. As a result of the scarcity of preclinical models relevant to 2D cultures,[98][12][99] 3D culture provides a pathophysiological microenvironment and has the potential to play a role in cancer drug discovery.[100][101][102][103][104] Tissue engineering requires 3D cellular scaffolds. As biomaterials, various natural and synthetic polymer hydrogels have been used by scientists to design 3D scaffolds. Since this barrier is a structure that mimics the natural ECM microenvironment, synthetic scaffolds may be more useful for studying specific tumorigenic steps.[35] Finally, it is suggested that the most suitable three-dimensional models should be carefully selected according to specific targets.[104] See also [edit] Cell culture Cell lines Cell culture assay Hydrogel Madin-Darby Canine Kidney cell line Microphysiometry
1850
dbpedia
2
61
https://search.lib.utexas.edu/discovery/fulldisplay%3Fdocid%3Dcdi_proquest_miscellaneous_2542364371%26context%3DPC%26vid%3D01UTAU_INST:SEARCH%26lang%3Den%26search_scope%3DMyInst_and_CI%26adaptor%3DPrimo%2520Central%26tab%3DEverything%26query%3Dcreator%252Cexact%252C%2520Ikegawa%252C%2520Shiro%2520%252CAND%26mode%3Dadvanced%26offset%3D0
en
[]
[]
[]
[ "" ]
null
[]
null
en
null
1850
dbpedia
0
4
https://journals.lww.com/md-journal/fulltext/2019/05310/diagnosis_of_hereditary_diffuse.40.aspx
en
Medicine
https://images.journals.…10-00040.F1.jpeg
https://images.journals.…10-00040.F1.jpeg
[ "https://cdn.wolterskluwer.io/wk-logos/1.0.x/favicon.png?rev=43", "https://journals.lww.com/_layouts/15/images/spcommon.png?rev=43", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F1.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F2.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F3.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F4.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.T1.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.T2.jpeg", "https://images.journals.lww.com/md-journal/XLargeThumb.00005792-202408160-00000.CV.jpeg", "https://journals.lww.com/_layouts/1033/IMAGES/OAKS.Journals/CAPrivacyPolicy.png" ]
[]
[]
[ "" ]
null
[]
null
erogeneities; also, it is classed as a neurodegenerative disease. Patient concerns: In preliminary clinical work, we identified a family with rapid progressive dementia. Diagnosis: Within this family, all patients had a CSF1R gene c.2696delA mutation (a deletion mutation), and head magnetic resonance imaging showed extensive white matter lesions. We diagnosed these patients with HDLS. Interventions: The proband was given hormonal treatments and immunoglobulin therapy, and his dementia symptoms have been relieved to a certain extent. Outcomes: After treatment, the symptoms of dementia were still progressively aggravated. However, the mutation site has not previously been reported. Lessons: This newly discovered mutation site may provide a new basis for the genetic diagnosis of HDLS disease in clinical work....
en
https://cdn.wolterskluwe….0.x/favicon.png
LWW
https://journals.lww.com/md-journal/fulltext/2019/05310/diagnosis_of_hereditary_diffuse.40.aspx
1 Introduction Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is a rare disease involving white matter lesions of the central nervous system, and it is usually inherited in an autosomal dominant fashion. It is a neurodegenerative disease with obvious clinical and genetic heterogeneities, and it has a complex pathogenesis and causes. More than 20 mutation sites related to this disease have been identified in colony-stimulating factor 1 receptor (CSF1R), located on chromosome 5q32.[1] Gene detection and pathological examination of brain tissue are needed for a definitive diagnosis of this disease. In our preliminary clinical work, we identified a family in which the proband and his mother both had rapid progressive dementia and extensive leukoencephalopathy as observed by head magnetic resonance imaging (MRI). We ran gene sequencing on family members and identified a CSF1R gene c.2696delA deletion mutation in the proband, and his mother and son. We thus diagnosed them with HDLS, although this mutation site has not been reported in previous literature. The cases are reported as follows. The case report was approved by the Ethics Committee of China-Japan Union Hospital of Jilin University, and all examinations of the patient were approved by the patient himself. Written informed consent was obtained from the patients. He also provided informed consent for publication of the findings. 2 Case report 2.1 Proband A 43-year-old male received treatment for 1 year because of progressive mental decline and character changes. The patient was admitted to hospital 1 year before this study, when he reported that his work was not satisfying, and he had memory deterioration, speech reduction, slow responses, character changes, irascibility, and unwillingness to communicate with people; he also expressed that “some people want to hurt me.” As the patient's condition worsened, he could no longer work. He underwent head MRI and other related examinations in another hospital and was diagnosed with leukoencephalopathy, and he was given symptomatic treatment including hormone and neurotrophic therapies; however, the patient's condition did not improve. 2.2 Physical examination The proband's blood pressure was 120/80 mm Hg, and his directive force, memory, and calculation ability were poor. His Mini-Mental State Examination (MMSE) score was 18 points (education <6 years) and he had cognitive deficiencies, and his clinical dementia rating (CDR) was 6 points. The patient was conscious, but had reduced speech capabilities. No obvious abnormalities were seen in the cranial nerve through physical examination, the muscular tension of all 4 limbs was normal, muscle force was level 5, no pathological reflexes were observed, and physical examination revealed no obvious abnormalities in residual nervous systems. 2.3 Head MRI scan and diffusion after admission to hospital In the left basal ganglia and bilateral corona radiata regions, there were multiple patchy long T1 and T2 signal shadows with well-demarcated margins. With FLAIR, there was a slightly high signal, and using DWI there was a patchy, slightly high signal; the regions around the anterior and posterior horns of the lateral ventricle were the most prominent. Using DWI, multiple patchy high signals in the bilateral frontal lobes and the left occipital lobe could be observed with well-demarcated margins. In addition, the genu of the corpus callosum had a slightly lower signal change in disseminated T1WI (Fig. 1). The lesion range was slightly increased compared with images at 3 months before admission. 2.4 Routine test of cerebrospinal fluid (CSF) In the proband, oligoclonal bands were negative, oligoclonal serum bands were negative, IgG synthesis rate of CSF was within the normal range, and AQP4 antibody was negative. Serum myelin basic protein levels were increased, autoantibody of myelin basic protein was positive, MOG antibody was positive, and blood–brain barrier permeability was elevated. No abnormalities were observed in 2 routine examinations and biochemical tests of CSF. 2.5 Proband's mother The proband's mother was a 70-year-old female who had received treatment for progressive mental decline and character changes for 10 years. The patient had poor memory ability and had changed from being well-spoken to being taciturn, unsociable, and short-tempered over the course of 10 years before being admitted into hospital. Her condition gradually worsened, and she eventually could not take care of herself. 2.6 Physical examination The patient's blood pressure was 145/90 mm Hg, and her directive force, memory, and calculation ability were poor. Her MMSE score was 15 points (education <6 years) and she had cognitive deficiencies, and her CDR was 5 points. The patient was conscious and could speak fluently. No obvious abnormalities were observed in the cranial nerve through physical examination, muscular tension of all 4 limbs was normal, muscle force was level 5, no pathological reflexes were observed, and physical examination revealed no obvious abnormalities in residual nervous systems. 2.7 Head MRI scan and diffusion In the bilateral frontal and parietal lobes, there was interspersed mottling and patchy equal or long T1 signal and slightly long T2 signal with obscure boundaries, and with FLAIR there was a slightly high signal. Laminated long T1 and T2 signal shadows could be observed in the temporal lobe, and there was a high signal using FLAIR; laminated long T1 and T2 signals could be observed within the lesion, and boundaries were obscure. Within the brainstem, body and genu of the corpus callosum, bilateral thalami, basal ganglia, corona radiata, and centrum semiovale, patchy and laminated long T1 and T2 signal shadows could be observed with obscure boundaries, and with FLAIR, there were low or high signal shadows. Within the left basal ganglia region, there were obvious long T1 and T2 signal shadows with arc-shaped signal loops, and where the bilateral lateral ventricles broadened, patchy long T1 and T2 signal shadows could be observed. With FLAIR, there was a high signal with obscure boundaries (Fig. 2). 2.8 Family survey A family survey was conducted after the informed consent of each family member, and each patient/family member provided informed consent for publication of the case. In the family, there were 12 nonsymptomatic members and 3 symptomatic patients, including 1 male (the proband) and 2 females (as shown in Fig. 3). The elder sister of the proband is deceased, but before her death, she gradually developed character changes and memory loss, and had rapid disease progression that meant that she could not take care of herself after 1 year of developing symptoms; she died 5 years before the current study was conducted. For all 3 symptomatic family members, there were no other clinical manifestations and they were healthy before developing symptoms. All nonsymptomatic family members had no obvious clinical symptoms. The proband and his mother both had rapidly progressing dementia, and their head MRIs showed extensive leukoencephalopathy; the proband also had a questionable medical history of nervous shock and psychological problems caused by the postnatal environment; however, his symptoms were similar to those of his sister, and his symptoms and imaging manifestations were also similar to those of his mother. Thus, the possibility of a hereditary disease was considered to be high (Fig. 3), and next-generation sequencing was performed in the proband and his mother to detect genes related to dementia. 2.9 The next-generation sequencing A standard phenol-chloroform extraction method was used to extract genomic DNA from peripheral blood. Next-sequencing was performed by Novogene Bioinformatics Institute. Following the manufacturer's procedures, more than 1.5 μg of genomic DNA from each sampled individual was cut by using a sonicator (Covaris); enriched, hybridized, and captured on the Agilent SureSelect Human All Exon V5; and sequenced using the Illumina HiSeq 2000 sequencer (Illumina Inc., San Diego, CA). Clean reads without adaptors or degraded readings were mapped to the human reference genome (UCSC hg19) using the Burrows-Wheeler alignment (BWA) tool. Single-nucleotide polymorphism (SNP) and insertions/deletions were identified by sequence alignment/map tools and then the identification process was repeated using Picard tag reading. We screened all variants against the SNP database, 1000 Genomes project, and the outer NHLBI exome sequencing projects (ESP) 6500. Functional prediction was carried out by Sorting Intolerant from Tolerant (SIFT) and Polymorphism Phenotyping version 2 (PolyPhen-2). Candidate variants were annotated by the ANNOVAR (Annotate Variation) software. Direct Sanger sequencing was then performed using an ABI 3500 sequencer (Applied Biosystems, Foster City, CA) to identify the CSF1R gene in the family. We revealed that both the proband and his mother had a heterozygous mutation of c.2696delA in the CSF1R gene (Fig. 4, Tables 1 and 2), and discovered the existence of a new mutation site—c.2696delA (a deletion mutation)—in CSF1R in the patient, which leads to the amino acid change p.His899fs (a frame-shift mutation). After consulting related articles and HGMDpro database, we could find no previous reports of this mutation. On the basis of the clinical characteristics, and also the results of imaging examinations and gene detection, the proband was diagnosed with HDLS and given steroid pulse therapy and immunoglobulin, which slightly relieved his dementia symptoms. During a follow-up visit 3 months after diagnosis, the patient's condition was observed to have gradually worsened, and the patient currently has difficulty communicating and cannot take care of himself in daily life, or relieve his bowels. 2.10 Ethical statement Ethics Committee of China-Japan Union Hospital of Jilin University has approved this study (the ethical approval number is 2019040810). 3 Discussion Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids is a hereditary degenerative disease of the nervous system that mainly manifests as rapidly progressing dementia, and it was reported both clinically and pathologically for the first time in 1984.[2] The major pathological feature of this disease is extensive leukoencephalopathy with neuroaxonal spheroids or demyelination. The main clinical manifestations include progressive cognitive impairments such as aphasia and dementia, and also motor impairments such as dyskinesia, Parkinson disease, and dystaxia because of the influence of the pyramidal tract; some patients may even have epileptic seizures.[3–5] The age of onset is generally between 30 and 50 years, and disease development is rapid: in most cases, the patient dies within a few years, and there are only a few reported cases of patients who have lived with the disease for decades.[2] HDLS is usually autosomal-dominant. CSF1R has been determined as a causative gene,[1] and the CSF1R protein that it encodes is a polypeptide containing 972 amino acids, and is a type III tyrosine kinase receptor that belongs to the platelet-derived growth factor (PDGF) receptor family. This receptor mainly influences the proliferation and differentiation of mononuclear macrophages and neurogliocytes.[6] The CSF1R gene is a common causative gene of HDLS, although there are other known causative genes including EIF2B2 and POLR3A.[7] In theory, a pathogenic mutation in just 1 chromosome may result in the disease. In 2012, Rademakers et al confirmed CSFlR as a causative gene of HDLS and reported that it is located on chromosome 5q32 and includes 22 exons. However, a later study confirmed that there are, in fact, 24 exons. Studies by Konno et al[8] reported that CSF1R mutations may play a role in the pathogenesis of HDLS by causing the dysfunction of microglial phagocytic (or “gitter”) cells, no matter what type of CSF1R mutation a patient might have or what clinical characteristics or neuroimaging features are observed. Until now, it has been reported that mutations in more than 60 genes can lead to leukoencephalopathy, among which NOTCH3, EIF2B5, AARS2, and CSF1R are the most common genes.[9] In CSF1R, more than 50 mutations can lead to disease states, and of these, 21 mutation sites are related to leukoencephalopathy. These include point mutations, missense mutations, and frame-shift mutations. In preliminary clinical work, we identified a rare HDLS family and discovered the existence of a new mutation site—c.2696delA (a deletion mutation)—in CSF1R in the patient, which leads to the amino acid change p.His899fs (a frame-shift mutation) and the deletion of CSF1R genes related with tumor-like lesions. After consulting related articles and mutation databases, we could find no previous reports of this mutation. This newly discovered mutation site provides a new basis for the genetic diagnosis of HDLS disease in the clinic. Genetic analysis suggested that the family in the current study conformed to the characteristics of autosomal dominant inheritance. The proband, his mother, and his son all carried this mutation, and the symptoms of his elder sister were similar to the symptoms of the proband; she is thus likely to have also suffered from this disease before her death. The proband's son is 15 years old and carries the gene mutation without any clinical symptoms of HDLS; it is considered that he has not yet reached the age of onset, and follow-up observations will continue for this individual. At present, there are no effective therapeutic drugs for this disease, and symptomatic treatment is the current treatment method. Apart from routine circulation improvement and neurotrophic drug therapy, the proband has also received hormonal treatments and immunoglobulin therapy, and his dementia symptoms have been relieved to a certain extent; however, his continuous deterioration cannot be reversed. We will continue to arrange follow-up treatment for this patient and the other mutation carriers in the family. In this study, there were the following limitations. First, the family members who underwent gene sequencing were few, and we were unable to perform gene sequencing on the father, brothers, and sisters of the proband, even after concerted efforts. Second, we were unable to perform pathological examination of the proband's brain tissue. Third, we did not further explore the possibly rare inheritance modes of HDLS. A study by Nicholson et al[7] indicated that the parents of individual HDLS patients do not have similar symptoms, and it is considered that the inheritance modes for some patients are unconventional. A final limitation is that we did not investigate the factors related to the age of onset in carriers of the mutated gene. Karle et al reported that a 28-year-old man carrying a CSF1R mutation was severely ill, but his 69-year-old father with the same mutation did not have similar symptoms and only showed some nonspecific leukodystrophies by MRI. However, it cannot be excluded that the father may develop symptoms at an older age. According to the latest research, the oldest reported age of HDLS onset is 71 years old.[6] Research into factors that may contribute to age of onset is important because it may allow early intervention in patients who carry or may carry disease genes, and could help in genetic counseling and when there is antenatal diagnosis in families. Author contributions Writing – original draft: Tianji Shi.
1850
dbpedia
1
6
https://en.wikipedia.org/wiki/Hereditary_diffuse_leukoencephalopathy_with_spheroids
en
Hereditary diffuse leukoencephalopathy with spheroids
https://upload.wikimedia…ant_-_en.svg.png
https://upload.wikimedia…ant_-_en.svg.png
[ "https://en.wikipedia.org/static/images/icons/wikipedia.png", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-wordmark-en.svg", "https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-tagline-en.svg", "https://upload.wikimedia.org/wikipedia/commons/thumb/4/4e/Autosomal_dominant_-_en.svg/220px-Autosomal_dominant_-_en.svg.png", "https://upload.wikimedia.org/wikipedia/commons/thumb/4/45/Leukencephalopathy.PNG/200px-Leukencephalopathy.PNG", "https://upload.wikimedia.org/wikipedia/commons/thumb/1/1c/Wiki_letter_w_cropped.svg/20px-Wiki_letter_w_cropped.svg.png", "https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1", "https://en.wikipedia.org/static/images/footer/wikimedia-button.svg", "https://en.wikipedia.org/static/images/footer/poweredby_mediawiki.svg" ]
[]
[]
[ "" ]
null
[ "Contributors to Wikimedia projects" ]
2011-12-30T22:14:56+00:00
en
/static/apple-touch/wikipedia.png
https://en.wikipedia.org/wiki/Hereditary_diffuse_leukoencephalopathy_with_spheroids
Medical condition Hereditary diffuse leukoencephalopathy with spheroids (HDLS)Other namesAdult-onset leukoencephalopathy with axonal spheroids and pigmented glia, Autosomal dominant leukoencephalopathy with neuroaxonal spheroidsHereditary diffuse leukoencephalopathy with spheroids is inherited in an autosomal dominant manner Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is a rare adult onset autosomal dominant disorder characterized by cerebral white matter degeneration with demyelination and axonal spheroids leading to progressive cognitive and motor dysfunction. Spheroids are axonal swellings with discontinuous or absence of myelin sheaths. It is believed that the disease arises from primary microglial dysfunction that leads to secondary disruption of axonal integrity, neuroaxonal damage, and focal axonal spheroids leading to demyelination. Spheroids in HDLS resemble to some extent those produced by shear stress in a closed head injury with damage to axons, causing them to swell due to blockage of axoplasmic transport. In addition to trauma, axonal spheroids can be found in aged brain, stroke, and in other degenerative diseases.[1] In HDLS, it is uncertain whether demyelination occurs prior to the axonal spheroids or what triggers neurodegeneration after apparently normal brain and white matter development, although genetic deficits suggest that demyelination and axonal pathology may be secondary to microglial dysfunction.[2] The clinical syndrome in patients with HDLS is not specific and it can be mistaken for Alzheimer's disease, frontotemporal dementia, atypical Parkinsonism, multiple sclerosis, or corticobasal degeneration.[3] Symptoms [edit] With symptoms of personality changes, behavioral changes, dementia, depression, and epilepsy, HDLS has been commonly misdiagnosed for a number of other diseases.[4] Dementia or frontotemporal behavioral changes, for example, have commonly steered some clinicians to mistakenly consider diagnoses such as Alzheimer's disease, frontotemporal dementia or atypical Parkinsonism. The presence of white matter changes has led to misdiagnosis of multiple sclerosis. HDLS commonly manifests with neuropsychiatric symptoms, progressing to dementia, and after a few years shows motor dysfunction. Eventually patients become reliant on wheelchairs.[3] White matter degeneration is associated with and makes differential diagnoses out of other adult onset leukodystrophies such as metachromatic leukodystrophy (MLD), Krabbe disease (globoid cell leukodystrophy), and X-linked adrenoleukodystrophy (X-ADL).[2] Disease Exclusive Trait MLD Accumulation of metachromatic material in white matter Krabbe Disease Presence of globoid cells derived from microglia which have multiple nuclei X-ALD Predominant parieto-occipital white matter abnormality Vanishing White Matter (VWM) Disease Increased white matter rarefaction Cystic degeneration Sparse dysmorphic astrocytes Scanty astogliosis Increased macroglia around cavity regions and lesser areas Foamy oligodendrocytosis Nasu-Hakola Pain and tenderness of ankles/feet/wrist Cystic bone lesions noticeable on radiological films [2] Neuropsychiatric symptoms [edit] Many neuropsychiatric symptoms have been identified in clinical studies of HDLS patients. These include severe depression and anxiety that have been identified in about 70% of HDLS families, verging on suicidal tendencies and substance abuse such as alcoholism. Additionally, patients may exhibit disorientation, confusion, agitation, irritability, aggressiveness, an altered mental state, the loss of the ability to execute learned movements (apraxia), or the inability to speak (mutism).[3] Motor impairment [edit] Persons with HDLS can develop tremors, decreased body movement, unsteadiness (Parkinsonism, muscles on one side of the body in constant contraction (spastic hemiparesis), impairment in motor and sensory function in the lower extremities (paraparesis), paralysis resulting in partial or total loss of all extremities and torso (tetraparesis), and the lack of voluntary coordination of muscle movements (ataxia).[3] Causes [edit] The cause of HDLS in most families is mutation in the colony stimulating factor 1 receptor (CSF1R), a growth factor for microglia and monocyte/macrophages, suggesting that microglial dysfunction may be primary in HDLS.[4] The mutations are concentrated in tyrosine kinase domain (TKD) of the protein. Mutations were mainly found in exons 12-22 of the intracellular TKD, including 10 missense mutations that have a single nucleotide deletion and a single codon deletion that consists of a triplet of nucleotides that have been removed causing a whole amino acid to not be coded. Additionally, three splice site mutations were identified that caused an in-frame deletion of an exon, an expressed nucleotide sequence, leading to the removal of more than 40 amino acids in the TKD.[4] This determination has based upon genetic studies of 14 HDLS families confirming mutations in this gene. The CSF1 receptor protein primarily functions in regulation, survival, proliferation, and differentiation of microglial cells.[5] The mechanism of microglial dysfunction due to mutations in CSF1R to the myelin loss and axonal spheroid formation remains unknown. Further research is needed to better understand disease pathogenesis. Pathology [edit] In HDLS, there is enlargement of the lateral ventricles and marked thinning or weakening of cerebral white matter.[6] The loss of white matter is caused by myelin loss. These changes are associated with diffuse gliosis, moderate loss of axons and many axonal spheroids.[1] Activated or ameboid microglia and macrophages that contain myelin debris, lipid droplets and brown autofluorescent pigment granules are found in the areas with demyelination and axonal spheroids. In severely degenerated areas there are many large, reactive astrocytes filled with glial fibrils.[1] In autopsy cases, it has been shown that white matter abnormalities are relatively confined to the cerebrum while avoiding the cerebellum and many of the major fiber tracts of the nervous system. The exception is the corticospinal tracts(pyramidal tracts) in the brainstem and sometimes spinal cord.[2] The brain pathology of HDLS resembles that of Nasu-Hakola disease (polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy).[7] Diagnosis [edit] Research as of 2012 includes investigations of microglial function. This work would further clarify whether the disease is primarily a defect in microglia function. For such a study, microglial cells from HDLS kindred can be cultured from autopsy brain and analyzed in comparison to normal microglial cells on the basis of differences in mutation occurrences and growth factor expression.[5] Differential diagnosis [edit] Related disorders in the same disease spectrum as HDLS include Nasu-Hakola disease (polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy), and a type of leukodystrophy with pigment-filled macrophages called pigmentary orthochromatic leukodystrophy (POLD).[3] In addition to white matter disease, Nasu-Hakola causes bone cysts. It is caused by mutations in the genes involved in the same colony stimulating factor (CSF) signaling pathway cascade as identified in HDLS.[8] Nasu-Hakola disease appears to be caused by mutations in the TYRO protein tyrosine kinase-binding protein (TYROBP - also known as DAP12) or the triggering receptor expressed on myeloid cells 2 (TREM2) protein. While different gene mutations occur within the pathway for Nasu-Hakola and HDLS, both are characterized by white matter degeneration with axonal spheroids. Current researchers in the field believe that more in depth analysis and comparison of the two genetic abnormalities in these disorders could lead to a better understanding of the disease mechanisms in these rare disorders. POLD exhibits noninflammatory demyelination of axons with initial symptoms of euphoria, apathy, headache, and executive dysfunction. While HDLS is autosomal dominant, some families with POLD have features that suggest autosomal recessive inheritance.[9] Nevertheless, POLD has recently been shown to have the same genetic basis as HDLS. Clinical and genealogic studies [edit] To gain a better understanding of the disease, researchers have retrospectively reviewed medical records of probands and others who were assessed through clinical examinations or questionnaires. Blood samples are collected from the families of the probands for genetic testing. These family members are assessed using their standard medical history, on their progression of Parkinson's like symptoms (Unified Parkinson's Disease Rating Scale), and on their progression of cognitive impairment such as dementia (Folstein Test).[2] Neuroimaging [edit] Standard MRI scans have been performed on 1.5 Tesla scanners with 5 mm thickness and 5 mm spacing to screen for white matter lesions in identified families. If signal intensities of the MRI scans are higher in white matter regions than in grey matter regions, the patient is considered to be at risk for HDLS, although a number of other disorders can also produce white matter changes and the findings are not diagnostic without genetic testing or pathologic confirmation.[2] Pathology [edit] Tissue sections from brain biopsies or autopsy brains are commonly embedded in paraffin from which sections are cut and mounted on glass slides for histologic studies. Special stains for myelin and axonal pathology show the abnormal changes that are characteristic of HDLS are identified in white matter of the neocortex, basal ganglia, thalamus, midbrain, pons and spinal cord.[2][10] In addition to routine histologic methods (H&E staining), samples are evaluated with immunohistochemistry for ubiquitin, amyloid precursor protein, and neurofilament to characterize axonal changes and myelin basic protein for myelin pathology. Immunohistochemical stains for microglia (CD68 or HLA-DR) and astrocytes (GFAP) are also helpful techniques to characterize white matter pathology.[6] With a similar pathology to POLD, HDLS is commonly grouped as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) so as to give these individually under-recognized conditions heightened attention.[3] Classification [edit] HDLS falls under the category of brain white matter diseases called leukoencephalopathies that are characterized by some degree of white matter dysfunction. HDLS has white matter lesions with abnormalities in myelin sheath around axons, where the causative influences are being continually explored based upon recent genetic findings. Studies by Sundal and colleagues from Sweden showed that a risk allele in Caucasians may be causative because cases identified have thus far been among large Caucasian families.[2] Management [edit] Epidemiology [edit] An average clinical profile from published studies shows that the median onset age for HDLS patients is 44.3 years with a mean disease duration of 5.8 years and mean age of death at 53.2 years.[2][11] As of 2012, there have been around 15 cases identified with at least 11 sporadic cases of HDLS.[2][11] HDLS cases have been located in Germany, Norway, Sweden, and the United States, showing an international distribution focusing between Northern Europe and the United States.[2] Through the study of numerous kindred, it was found that the disease did not occur among just males or females, but rather was evenly distributed indicative of an autosomal rather than a sex-linked genetic disorder. It was also observed that the HDLS cases did not skip generations as it would occur with a recessive inheritance, and as such has been labeled autosomal dominant.[2] History [edit] This disease was first described in 1984 by Axelsson et al. in a large Swedish pedigree.[12] It is a disorder better known to neuropathologists than clinicians. A neuropathologist with an interest in HDLS, Dr. Dennis W. Dickson, has identified a number of cases from neuropathology study of brains submitted for investigation of familial adult-onset dementia and movement disorders in New York and later in Florida. Recognition of the importance of this disorder as a cause of adult onset dementia and movement disorders was further heightened in 1997 at the Mayo Clinic when Dr. Zbigniew K. Wszolek identified a family with HDLS that was initially thought to be due to another disease process (FTDP-17), but only an autopsy of one and then other family members revealed it to be HDLS. Wszolek established an international consortium in 2005 to identify other families and to collect DNA or brain samples from family members for neuropathologic confirmation and genetic research at the Mayo Clinic in Florida.[2] See also [edit] Neurodegeneration Leukoencephalopathy with vanishing white matter Leukoencephalopathy with neuroaxonal spheroids Microcephaly
1850
dbpedia
1
13
https://www.healthpartners.com/blog/is-high-cholesterol-hereditary/
en
Is high cholesterol hereditary? What you need to know
https://www.healthpartne…397-2000x666.jpg
https://www.healthpartne…397-2000x666.jpg
[]
[]
[]
[ "" ]
null
[ "Kaitlyn Votel", "HealthPartners" ]
2024-07-05T15:02:52+00:00
Familial hypercholesterolemia is a genetic disorder that causes high cholesterol. Learn about the risk factors and treatments for hereditary high cholesterol.
en
https://www.healthpartners.com/content/dam/brand-identity/icons/hp-favicon.ico
HealthPartners Blog
https://www.healthpartners.com/blog/is-high-cholesterol-hereditary/
Cholesterol is a waxy, fat-like substance in your blood stream that helps with digesting fatty foods and making hormones. It’s essential for good health. However, having too much cholesterol can cause heart disease, strokes and other health issues. High cholesterol is a common condition that affects about 2 out of 5 Americans. There are a number of factors that can affect your cholesterol levels, including diet, activity level, lifestyle and genetics. High cholesterol may also be caused by a hereditary condition called familial hypercholesterolemia (FH). People with FH aren’t able to manage their cholesterol levels with lifestyle changes alone, and they have a significantly increased risk of developing heart disease and other health concerns. Knowing if you have hereditary high cholesterol can give you a better understanding of your personal health risks. Diagnosing and treating FH early can reduce your risk of heart disease by around 80%. Learn more about familial hypercholesterolemia, how to manage it and available genetic screenings. Familial hypercholesterolemia is a genetic disorder that affects how the body regulates cholesterol Your body produces two types of proteins that carry cholesterol. These proteins have different impacts on your overall health: High-density lipoprotein (HDL) – carries cholesterol away from the arteries. It’s considered the “good” kind of cholesterol protein because higher levels of it can lower your risk of heart disease. Low-density lipoprotein (LDL) – carries cholesterol to your artery walls. This increases your risk of heart disease and is considered the “bad” kind of cholesterol protein. Familial hypercholesterolemia is a genetic disorder that causes increased levels of LDL cholesterol in the bloodstream. FH is different than other types of high cholesterol because people who have FH aren’t able to maintain healthy levels of LDL through lifestyle choices, like regular activity, a balanced diet and other methods. Instead, medications are often needed to control cholesterol levels. Without proper care, people with FH are significantly more likely to develop heart disease, and develop it at a younger age, than those without it. Familial hypercholesterolemia can be caused by a genetic change (mutation) in one of four different genes (LDLR, LDLRAP1, APOB and PCSK9). These genes play a role in how the body regulates cholesterol and removes it from your blood. Between 60-80% of people diagnosed with FH have a mutation in at least one of these four genes. Since familial hypercholesterolemia impacts the body’s ability to keep levels of LDL cholesterol in the healthy range, fatty plaque builds up in the veins and arteries. This greatly increases the risk of a heart attack, stroke, heart failure and heart disease. There are two types of familial hypercholesterolemia Heterozygous FH (HeFH) is the most common type of familial hypercholesterolemia. In this case, someone has inherited the gene mutation from one parent. People with this type of familial hypercholesterolemia may develop heart disease as young as 30 years old. Homozygous FH (HoFH) is a rare form of FH where someone inherits gene mutations from both parents. This type of FH is more severe and can cause LDL cholesterol levels above 400 mg/dL. Without early detection and treatment, it’s possible for someone with HoFH to develop heart disease within the first 10 years of life. Signs of familial hypercholesterolemia Both adults and children can be diagnosed with FH. It’s most commonly detected through regular cholesterol screenings (lipid panels). LDL levels over 190 mg/dL in adults or 160 mg/dL in children can be an indicator of familial hypercholesterolemia. However, having high cholesterol doesn’t mean that it’s caused by a hereditary condition like FH. Typically, someone with familial hypercholesterolemia also has a family history of heart attacks or early onset heart disease. It’s important to talk with your doctor about your family health history because this can help identify FH. Familial hypercholesterolemia can also cause cholesterol to build up in different parts of the body. This can create physical signs of FH, which include: A whitish-gray ring around the cornea and iris in your eye Yellow bumps around your eyes and on the eyelids Bumps on the knuckles, elbows or knees Thickened Achilles tendons Keep in mind that not everyone with familial hypercholesterolemia develops these physical signs. How to manage familial hypercholesterolemia Early detection is key to managing FH. The earlier you’re diagnosed, the earlier your doctor can start you on a treatment plan that keeps your LDL cholesterol level low and reduces your risk of heart disease. Typically, treatment plans for familial hypercholesterolemia include some type of statin, a class of medications that lowers the cholesterol in the blood. Depending on your needs, your doctor might also prescribe other types of medications. Eating a whole food diet rich in plants, getting enough physical exercise, limiting alcohol and other lifestyle choices can help manage your cholesterol levels in addition to medications or other treatments. Your doctor will talk with you about steps you can take to keep your cholesterol levels under control. If needed, you may be referred to a cardiologist or other lipid specialist with experience managing FH. Genetic testing to determine if you have familial hypercholesterolemia The majority of people with high levels of LDL don’t have hereditary high cholesterol. But if you have a family history of heart disease or a family history of familial hypercholesterolemia, you might benefit from genetic testing. Genetic testing for familial hypercholesterolemia is often recommended for people who have: Physical signs of FH High LDL levels above 190 mg/dL that can’t be managed with lifestyle changes A family history of heart disease A family history of FH Genetic counselors and DNA health screenings are two options that can provide genetic testing services for hereditary high cholesterol. Genetic counselors Genetic counselors talk with you about your family medical history, counsel on your genetic health risks and coordinate clinical genetic testing. They also discuss what your test results mean for you and your family. If needed, genetic counselors can also guide you toward additional care you might need to manage your health risks. In order to meet with a genetic counselor, you typically need a referral from another doctor. Insurance coverage for genetic counseling services varies depending on your insurance plan. DNA health studies and screening programs are a good place to start for genetic screening for familial hypercholesterolemia. In Minnesota, you can get screening through myGenetics at no cost to you. This large-scale community health research study provides you with information about three hereditary conditions: familial hypercholesterolemia, Lynch syndrome (hereditary colon cancer), and hereditary breast and ovarian cancer. You can also get information from myGenetics about regional ancestry and traits like caffeine sensitivity.
1850
dbpedia
2
85
https://encyclopedia.pub/video/video_detail/342
en
The Lipid Energy Model
https://videodelivery.ne…me=1s&height=270
https://videodelivery.ne…me=1s&height=270
[ "https://encyclopedia.pub/build/images/header_logo.png", "https://encyclopedia.pub/build/images/feedback_success.png" ]
[]
[]
[ "" ]
null
[]
null
Encyclopedia is a user-generated content hub aiming to provide a comprehensive record for scientific developments. All content free to post, read, share and reuse.
en
/favicon.ico
https://encyclopedia.pub/video/video_detail/342
When lean people adopt carbohydrate-restricted diets (CRDs), they may develop a lipid profile consisting of elevated LDL-cholesterol (LDL-C) and HDL-cholesterol (HDL-C) with low triglycerides (TGs). The magnitude of this lipid profile correlates with BMI such that those with lower BMI exhibit larger increases in both LDL-C and HDL-C. The inverse association between BMI and LDL-C and HDL-C change on CRD contributed to the discovery of a subset of individuals—termed Lean Mass Hyper-Responders (LMHR)—who, despite normal pre-diet LDL-C, as compared to non- LMHR (mean levels of 148 and 145 mg/dL, respectively), exhibited a pronounced hyperlipidemic response to a CRD, with mean LDL-C and HDL-C levels increasing to 320 and 99 mg/dL, respectively, in the context of mean TG of 47 mg/dL. In some LMHR, LDL-C levels may be in excess of 500 mg/dL, again, with relatively normal pre-diet LDL-C and absent of genetic findings indicative of familial hypercholesterolemia in those who have been tested. The Lipid Energy Model (LEM) attempts to explain this metabolic phenomenon by positing that, with carbohydrate restriction in lean persons, the increased dependence on fat as a metabolic substrate drives increased hepatic secretion and peripheral uptake of TG contained within very low-density lipoproteins (VLDL) by lipoprotein lipase, resulting in marked elevations of LDL-C and HDL-C, and low TG.
1850
dbpedia
0
24
https://mayoclinic.elsevierpure.com/en/publications/hereditary-diffuse-leukoencephalopathy-with-axonal-spheroids-hdls
en
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS): A misdiagnosed disease entity
https://mayoclinic.elsevierpure.com/skin/headerImage/
https://mayoclinic.elsevierpure.com/skin/headerImage/
[ "https://mayoclinic.elsevierpure.com/skin/headerImage/" ]
[]
[]
[ "" ]
null
[ "Christina Sundal", "Jennifer Lash", "Jan Aasly", "Sarka Øygarden", "Sigrun Roeber", "Hans Kretzschman", "James Y. Garbern", "Alex Tselis", "Rosa Rademakers", "Dennis W. Dickson" ]
null
en
Mayo Clinic
https://mayoclinic.elsevierpure.com/en/publications/hereditary-diffuse-leukoencephalopathy-with-axonal-spheroids-hdls
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) was originally described in a large Swedish pedigree. Since then, 22 reports describing a total of 13 kindreds and 11 sporadic cases have been published. Inheritance is autosomal dominant, albeit the gene is unknown. Here we report on the clinical findings, genealogical data, brain MRI data, and autopsy/biopsy findings of four probands from three independently ascertained novel families from Norway, Germany and US. We identified a 39-year-old female and her twin sister, a 52-year-old male and a 47-year-old male with progressive neurological illness characterized by personality changes, cognitive decline and motor impairments, such as gait problems, bradykinesia, tremor and rigidity. Brain MRI showed white matter abnormalities with frontal prominence. Brain biopsy/autopsies were consistent with HDLS. HDLS is an under-recognized disease and in reporting these cases, we aim to increase the awareness of the disorder. Due to varied and wide phenotypic presentations, which may imitate several neurodegenerative diseases, HDLS can be difficult to diagnose. Definitive diagnosis can be established only by direct brain tissue examination. Familiarity with the clinical presentation and typical neuroimaging findings may be helpful in narrowing the diagnosis. TY - JOUR T1 - Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) T2 - A misdiagnosed disease entity AU - Sundal, Christina AU - Lash, Jennifer AU - Aasly, Jan AU - Øygarden, Sarka AU - Roeber, Sigrun AU - Kretzschman, Hans AU - Garbern, James Y. AU - Tselis, Alex AU - Rademakers, Rosa AU - Dickson, Dennis W. AU - Broderick, Daniel AU - Wszolek, Zbigniew K. N1 - Funding Information: Work was partially supported by the NIH/NINDS 1RC2NS070276, NS057567, P50NS072187 , Mayo Clinic Florida (MCF) Research Committee CR program (MCF # 90052030 ), Dystonia Medical Research Foundation , and a gift from Carl Edward Bolch, Jr., and Susan Bass Bolch (MCF #90052031/PAU #90052). Funding Information: DWD was supported by P50NS072187 and a gift from Carl Edward Bolch, Jr., and Susan Bass Bolch. SR and HK were both funded by BMBF (Brain-Net-Germany (01GI0505)). Funding Information: Rademakers: NIH R01 AG026251-03A2, P50AG 16574, R01NS065782, ALS Association, Society for Progressive Supranuclear Palsy, Frontotemporal Dementia Research, Fidelty Foundation Funding Information: CS was sponsored by Anna-Lisa och Bror Björnssons, Sven and Dagmar Saléns, Signe och Olof Wallenius and Gamla Tjänarinnor Foundations, Sweden. The Swedish Society of Medicine Gothenburg (GLS), Sweden, The Swedish Society of Medicine Sweden, The Swedish and Gothenburg Societies for the Neurologically Disabled and The Gothenburg Foundation for Neurological Research. PY - 2012/3/15 Y1 - 2012/3/15 N2 - Hereditary diffuse leukoencephalopathy with spheroids (HDLS) was originally described in a large Swedish pedigree. Since then, 22 reports describing a total of 13 kindreds and 11 sporadic cases have been published. Inheritance is autosomal dominant, albeit the gene is unknown. Here we report on the clinical findings, genealogical data, brain MRI data, and autopsy/biopsy findings of four probands from three independently ascertained novel families from Norway, Germany and US. We identified a 39-year-old female and her twin sister, a 52-year-old male and a 47-year-old male with progressive neurological illness characterized by personality changes, cognitive decline and motor impairments, such as gait problems, bradykinesia, tremor and rigidity. Brain MRI showed white matter abnormalities with frontal prominence. Brain biopsy/autopsies were consistent with HDLS. HDLS is an under-recognized disease and in reporting these cases, we aim to increase the awareness of the disorder. Due to varied and wide phenotypic presentations, which may imitate several neurodegenerative diseases, HDLS can be difficult to diagnose. Definitive diagnosis can be established only by direct brain tissue examination. Familiarity with the clinical presentation and typical neuroimaging findings may be helpful in narrowing the diagnosis. AB - Hereditary diffuse leukoencephalopathy with spheroids (HDLS) was originally described in a large Swedish pedigree. Since then, 22 reports describing a total of 13 kindreds and 11 sporadic cases have been published. Inheritance is autosomal dominant, albeit the gene is unknown. Here we report on the clinical findings, genealogical data, brain MRI data, and autopsy/biopsy findings of four probands from three independently ascertained novel families from Norway, Germany and US. We identified a 39-year-old female and her twin sister, a 52-year-old male and a 47-year-old male with progressive neurological illness characterized by personality changes, cognitive decline and motor impairments, such as gait problems, bradykinesia, tremor and rigidity. Brain MRI showed white matter abnormalities with frontal prominence. Brain biopsy/autopsies were consistent with HDLS. HDLS is an under-recognized disease and in reporting these cases, we aim to increase the awareness of the disorder. Due to varied and wide phenotypic presentations, which may imitate several neurodegenerative diseases, HDLS can be difficult to diagnose. Definitive diagnosis can be established only by direct brain tissue examination. Familiarity with the clinical presentation and typical neuroimaging findings may be helpful in narrowing the diagnosis. KW - Autosomal dominant KW - Cognitive problems KW - Depression KW - HDLS KW - Parkinsonism KW - Personality changes KW - White matter disease UR - http://www.scopus.com/inward/record.url?scp=84857038050&partnerID=8YFLogxK UR - http://www.scopus.com/inward/citedby.url?scp=84857038050&partnerID=8YFLogxK U2 - 10.1016/j.jns.2011.10.006 DO - 10.1016/j.jns.2011.10.006 M3 - Article C2 - 22050953 AN - SCOPUS:84857038050 SN - 0022-510X VL - 314 SP - 130 EP - 137 JO - Journal of the neurological sciences JF - Journal of the neurological sciences IS - 1-2 ER -
1850
dbpedia
3
4
https://www.heart.org/en/health-topics/cholesterol/hdl-good-ldl-bad-cholesterol-and-triglycerides
en
HDL (Good), LDL (Bad) Cholesterol and Triglycerides
https://www.heart.org/-/…using-laptop.jpg
https://www.heart.org/-/…using-laptop.jpg
[ "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Header/AHA_100_years_anniversary_header_logo.svg?h=100&w=100&hash=0BF053C1520764CC443D6AFDCB0E3620", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Header/AHA_100_years_anniversary_header_logo.svg?h=90&w=70&hash=148E2949031CA697056C8852B1E38CDD", "https://www.heart.org/-/media/Feature/Navigation/TopNav/donateheartwhite.svg?h=20&iar=0&mw=960&w=22", "https://www.heart.org/-/media/Project/Common/glyphs/search.svg?h=24&iar=0&mw=960&w=24", "https://www.heart.org/-/media/Project/Common/glyphs/search.svg?h=24&w=24&hash=149753609F0313041CE6054C4120AFCD", "https://www.heart.org/-/media/Feature/Navigation/Social/x_aha.svg?h=54&iar=0&mw=960&w=54", "https://www.heart.org/-/media/Feature/Navigation/Social/facebook-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/instagram-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/youtube-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/pinterest-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/linkedin-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Images/Health-Topics/Video-Thumbnails/Cholesterol-What-is-video.jpg?h=720&w=1280&hash=A7638E809E9A635F9B7B54A64543598B", "https://www.heart.org/-/media/Images/Health-Topics/Cholesterol/What-is-Cholesterol.jpg", "https://www.heart.org/-/media/Images/Health-Topics/Watch-Learn-and-Live/Cholesterol.jpg", "https://www.heart.org/-/media/Feature/Navigation/Social/x_color.svg?h=54&iar=0&mw=960&w=54", "https://www.heart.org/-/media/Feature/Social/facebookV1.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Social/linkedin.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Social/mail.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Social/copylink.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Social/print.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Images/Health-Topics/Cholesterol/doctor-reviewing-chart-with-patient.jpg?h=503&w=800&hash=5BEDF96ECCA1CFB0B29C607891842824", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Footer/CentennialBoldHeartsBadgew.png?h=130&w=130&sc_lang=en", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Footer/AHA_100_years_bold_hearts_footer_logo.png?h=142&iar=0&mw=960&w=150", "https://www.heart.org/-/media/Feature/Navigation/Social/facebook-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/instagram-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/x_aha.svg?h=54&iar=0&mw=960&w=54", "https://www.heart.org/-/media/Feature/Social/Tiktok_grey.png?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/youtube-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/linkedin-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Feature/Navigation/Social/pinterest-gray.svg?h=52&iar=0&mw=960&w=52", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Footer/nhc_optimized.png?h=50&iar=0&mw=960&w=49", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Footer/Better_Business_Bureau_logo.png?h=60&iar=0&mw=960&w=38", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Footer/Charity_Navigator_logo_120.jpg?h=60&iar=0&mw=960&w=120", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Footer/sectigo_trust_seal_140w.png?h=54&iar=0&mw=960&w=140&sc_lang=en", "https://www.heart.org/-/media/Images/Logos/Global-Do-No-Edit/Two-Click/ahalogo.png?h=165&w=280&hash=168DCCAE6E56E2ADD3D1F722F15D5C58" ]
[]
[]
[ "" ]
null
[]
2018-01-11T00:00:00
Two types of lipoproteins carry cholesterol to and from cells. One is low-density lipoprotein, or LDL. The other is high-density lipoprotein, or HDL. A test measures the amount of each type of cholesterol in your blood.
en
/favicon.ico
www.heart.org
https://www.heart.org/en/health-topics/cholesterol/hdl-good-ldl-bad-cholesterol-and-triglycerides
Cholesterol: The good and the bad Two types of lipoproteins carry cholesterol to and from cells. One is low-density lipoprotein, or LDL. The other is high-density lipoprotein, or HDL. A test measures the amount of each type of cholesterol in your blood. LDL cholesterol LDL cholesterol is considered the “bad” cholesterol because it contributes to fatty buildups in arteries (atherosclerosis). This narrows the arteries and increases the risk for heart attack, stroke and peripheral artery disease, or PAD. What Does My LDL Number Mean? (PDF) | Spanish (PDF) Why Should I Know My LDL Cholesterol? (PDF) | Spanish (PDF) HDL cholesterol HDL cholesterol can be thought of as the “good” cholesterol because a healthy level may help protect against heart attack and stroke. HDL carries LDL (bad) cholesterol away from the arteries and back to the liver, where the LDL is broken down and passed from the body. But HDL cholesterol doesn't eliminate LDL cholesterol. Only a fraction of blood cholesterol is carried by HDL. Triglycerides Triglycerides are the most common type of fat in the body. They store excess energy from your diet. A high triglyceride level combined with high LDL cholesterol or low HDL cholesterol is linked with fatty buildups within the artery walls, which increases the risk of heart attack and stroke. Download What is Cholesterol? (PDF) |Spanish (PDF) Watch an animation about cholesterol.
1850
dbpedia
3
67
https://www.modernheartandvascular.com/difference-between-ldl-and-hdl-cholesterol/
en
The Difference Between LDL and HDL Cholesterol
https://www.modernhearta…t-health-min.jpg
https://www.modernhearta…t-health-min.jpg
[ "https://www.facebook.com/tr?id=1689879725156096&ev=PageView &noscript=1", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/10/header-logo.png 609w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/10/header-logo-300x77.png 300w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/10/qr-code-150x150.png 150w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/10/qr-code.png 285w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/01-The-best-exercises-for-heart-health-min-1024x473.jpg 1024w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/01-The-best-exercises-for-heart-health-min-300x138.jpg 300w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/01-The-best-exercises-for-heart-health-min-768x354.jpg 768w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/01-The-best-exercises-for-heart-health-min.jpg 1300w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/El-colesterol-alto-y-las-estatinas.png 769w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/El-colesterol-alto-y-las-estatinas-300x300.png 300w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/El-colesterol-alto-y-las-estatinas-150x150.png 150w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/Cholesterol_Infographics_817w_FINAL-1.jpg 817w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/Cholesterol_Infographics_817w_FINAL-1-300x212.jpg 300w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/Cholesterol_Infographics_817w_FINAL-1-768x541.jpg 768w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/healthy-food.jpg 580w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/04/healthy-food-300x195.jpg 300w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2020/11/header-logo.jpg 609w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2020/11/header-logo-300x77.jpg 300w", "https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/10/header-logo.png 609w, https://cdn-ilbdkgn.nitrocdn.com/KyPgQQQAVfBmOoLeBzkzAekksAGOgYiS/assets/images/optimized/rev-22d7d62/www.modernheartandvascular.com/wp-content/uploads/2022/10/header-logo-300x77.png 300w" ]
[]
[]
[ "" ]
null
[ "Growth360Partners" ]
2022-04-13T17:44:37+00:00
There are two main types of cholesterol, including high-density lipoprotein and low-density lipoprotein. Learn the difference between LDL and HDL cholesterol.
en
https://cdn-ilbdkgn.nitr…icon-150x150.png
Modern Heart and Vascular
https://www.modernheartandvascular.com/difference-between-ldl-and-hdl-cholesterol/
Cholesterol is a waxy substance found in the blood, created by the liver and the foods you eat. Two lipoproteins carry your cholesterol, including low-density lipoprotein (LDL) and high-density lipoprotein (HDL). LDL is commonly referred to as bad cholesterol. LDL comprises the larger portion of your overall cholesterol count. LDL is referred to as bad or unhealthy cholesterol because it contributes to atherosclerosis, which are fatty buildups in arteries. Atherosclerosis can increase the risk of heart attack, peripheral artery disease (PAD) and stroke because it narrows the arteries. Approximately 54.5% of adults in the United States who could benefit from cholesterol medication are taking this medicine. Around 94 million adults in the United States 20 or older have elevated total cholesterol levels exceeding 200mg/dL. Cholesterol won’t dissolve in your blood. Instead, proteins known as lipoproteins carry the cholesterol where it needs to go within the body. Elevated LDL cholesterol levels can increase the risk of many medical conditions, including heart disease and coronary artery disease. Healthy cholesterol levels help the body manufacture hormones, support cell membranes, convert vitamin D in the skin and aid in digestion. Elevated LDL cholesterol levels cause cholesterol buildup in the arteries, commonly known as plaque. Over time, plaque builds up, narrowing the vessels further. Narrow vessels mean reduced blood flow to your body’s organs and heart. Reduced blood flow can cause chest pain (angina) and increase the risk of heart attacks. Research shows higher levels of LDL are directly associated with an elevated risk for heart disease. Each year, approximately 805,000 people in the United States experience a heart attack, with 605,000 occurrences being the first heart attack. LDL levels often rise if you eat a diet high in salt, saturated fats and cholesterol, usually found in dairy, processed foods and fatty meats. Lack of exercise, weight, tobacco and alcohol use, genetics, medications and existing health conditions may also raise the risk of high LDL levels.
1850
dbpedia
1
91
https://www.orpha.net/en/disease/detail/313808
en
onset leukoencephalopathy with axonal spheroids and pigmented glia
[ "https://www.orpha.net/build/images/logo-orphanet.png", "https://www.orpha.net/build/images/logo-orphanews.png", "https://www.orpha.net/build/images/logo-orphadata.png", "https://www.orpha.net/build/images/logo-ordo.png", "https://www.orpha.net/build/images/logoMain.png", "https://www.orpha.net/build/images/ERN.png", "https://www.orpha.net/build/images/FSMR.png", "https://www.orpha.net/build/images/partners/logo-inserm.png", "https://www.orpha.net/build/images/partners/logo-sante_jeunesse_sports.png", "https://www.orpha.net/build/images/partners/logo-CEE_RDPortal.jpg", "https://www.orpha.net/build/images/partners/logo-AFM.jpg", "https://www.orpha.net/build/images/partners/groupama.jpg", "https://www.orpha.net/build/images/partners/Institut-Francais-de-Bioinformatique-IFB-petit.png", "https://www.orpha.net/build/images/partners/IRDIRC_logo3-Recomm-Recogn.jpg", "https://www.orpha.net/build/images/partners/HVP_Logo.png", "https://www.orpha.net/build/images/partners/GA_logo_100px.png", "https://www.orpha.net/build/images/partners/Logo_CDR-mini.png", "https://www.orpha.net/build/images/partners/gcbr-logo.jpg", "https://www.orpha.net/build/images/ios.gif" ]
[]
[]
[ "" ]
null
[]
null
en
/build/images/favicon.png
null
Knowledge on rare diseases and orphan drugs COVID-19 & Rare diseases Rare Diseases Resources for Refugees/Displaced Persons Homepage > Rare diseases > Search Search for a rare disease * (*) mandatory field Disease name OMIM disease Gene name or symbol ORPHAcode ICD-10 ICD-11 Other search option(s) Alphabetical list Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia Suggest an update Your message has been sent Your message has not been sent. Please contact an administrator. Comment Form X Disease definition Hereditary diffuse leukoencephalopathy with axonal spheroids and pigmented glia is a rare autosomal dominant disease characterized by a complex phenotype including progressive dementia, apraxia, apathy, impaired balance, parkinsonism, spasticity and epilepsy. ORPHA:313808 Classification level: Disorder Synonym(s): ALSP Autosomal dominant leukoencephalopathy with neuroaxonal spheroids FPSG Familial dementia, Neumann type Familial progressive subcortical gliosis GPSC HDLS Hereditary diffuse leukoencephalopathy with spheroids POLD Pigmentary orthochromatic leukodystrophy Subcortical gliosis of Neumann Prevalence: <1 / 1 000 000 Inheritance: Autosomal dominant Age of onset: Adult ICD-10: G93.4 OMIM: 221820 UMLS: C3711381 MeSH: C580150 GARD: 10981 A summary on this disease is available in Français (2014) Español (2014) Nederlands (2014) Detailed information General public Article for general public Svenska (2018) - Socialstyrelsen Guidelines Clinical practice guidelines Deutsch (2022) - AWMF Disease review articles Clinical genetics review English (2017) - GeneReviews : produced/endorsed by ERN(s) : produced/endorsed by FSMR(s) Additional information Further information on this disease Classification(s) (2) Gene(s) (2) Patient-centred resources for this disease Expert centres (236) Networks of expert centre (9) Diagnostic tests (31) Patient organisations (119) Federation/alliance(s) (44) Orphan designation(s) and orphan drug(s) (2) Research activities on this disease Research projects (56) Biobanks (12) Registries (21) Network of experts (7) Newborn screening Newborn screening library The documents contained in this website are presented for information purposes only. The material is in no way intended to replace professional medical care by a qualified specialist and should not be used as a basis for diagnosis or treatment.
1850
dbpedia
2
1
https://jnnp.bmj.com/content/87/5/512
en
Hereditary leukoencephalopathy with axonal spheroids: a spectrum of phenotypes from CNS vasculitis to parkinsonism in an adult onset leukodystrophy series
https://jnnp.bmj.com/sit…cover-source.jpg
https://jnnp.bmj.com/sit…cover-source.jpg
[ "https://jnnp.bmj.com/sites/default/themes/bmjj/img/logos/logo-bmj-journals.svg", "https://resources.bmj.com/repository/journals-network-project/images/journal-logos/logo-jnnp.svg", "https://jnnp.bmj.com/sites/default/themes/bmjj/img/icon-pdf.png", "https://jnnp.bmj.com/sites/default/themes/bmjj/img/icon-pdf.png", "https://jnnp.bmj.com/sites/all/modules/contrib/panels_ajax_tab/images/loading.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F1.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F1.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F2.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F2.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F3.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F3.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F4.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F4.medium.gif" ]
[]
[]
[ "" ]
null
[ "David S Lynch", "Zane Jaunmuktane", "Una-Marie Sheerin", "Rahul Phadke", "Sebastian Brandner", "Ionnis Milonas", "Andrew Dean", "Nin Bajaj", "Nuala McNicholas", "Daniel Costello" ]
2016-05-01T00:00:00
Background Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is a hereditary, adult onset leukodystrophy which is characterised by the presence of axonal loss, axonal spheroids and variably present pigmented macrophages on pathological examination. It most frequently presents in adulthood with dementia and personality change. HDLS has recently been found to be caused by mutations in the colony stimulating factor-1 receptor ( CSF1R ) gene. Methods In this study, we sequenced the CSF1R gene in a cohort of 48 patients from the UK, Greece and Ireland with adult onset leukodystrophy of unknown cause. Results Five pathogenic mutations were found, including three novel mutations. The presentations ranged from suspected central nervous system (CNS) vasculitis to extrapyramidal to cognitive phenotypes. The case histories and imaging are presented here, in addition to neuropathological findings from two cases with novel mutations. Conclusion We estimate that CSF1R mutations account for 10% of idiopathic adult onset leukodystrophies and that genetic testing for CSF1R mutations is essential in adult patients presenting with undefined CNS vasculitis or a leukodystrophy with prominent neuropsychiatric signs or dementia.
en
https://jnnp.bmj.com/sites/default/themes/bmjj/favicon.ico
Journal of Neurology, Neurosurgery & Psychiatry
https://jnnp.bmj.com/content/87/5/512
Introduction Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is an autosomal dominant, adult onset leukodystrophy which typically presents with early onset cognitive or personality change. It is characterised by a distinct neuropathological appearance consisting of axonal loss in the cerebral white matter, axonal spheroids and variably present pigmented microglia. In 2011, it was discovered that heterozygous mutations in the colony stimulating factor-1 receptor (CSF1R) gene cause HDLS.1 In addition, it was shown that pigmented orthochromatic leukodystrophy (POLD) is also caused by CSF1R mutations and that POLD and HDLS exist on a spectrum.2 Previous studies have estimated that CSF1R mutations account between 10% and 25% of adult onset leukodystrophies, depending on the population studied.3 ,4 The clinical phenotype of patients with HDLS is variable, but the most common symptoms include cognitive decline, personality change and depression. Additional symptoms occur frequently and include parkinsonism, spasticity and seizures. Median age of onset is 45 years, although patients with onset as young as 18 have been described. Median life expectancy is 6 years but this is also variable, and some patients have survived for up to 29 years after symptom onset.3 ,5 All mutations identified to date have been found in the tyrosine kinase domain of the protein (exons 12–21) with exons 18, 19 and 20 containing the majority of the mutations (see figure 1 and online supplementary table S1). CSF1R is a cell surface receptor that is highly expressed on cells of the myeloid lineage including the microglia of the central nervous system (CNS).6 It is activated by the cytokines colony stimulating factor-1 (CSF1) and interleukin-34. The receptor consists of an extracellular ligand binding domain, a transmembrane domain and an intracellular tyrosine kinase domain.6 Binding of CSF1 to the CSF1R receptor results in receptor homodimerisation and the autophosphorylation of a number of tyrosine residues in the intracellular domain. This is followed by activation of several signalling pathways including Src,7 AKT, Erk and phospholipase C-γ.8 CSF1R activation therefore regulates microglial survival, proliferation and differentiation. Results We sequenced the CSF1R gene in the 48 patients presenting with adult onset leukodystrophy of unknown cause from the UK, Greece and Ireland and identified five patients carrying mutations in the gene (including 3 novel mutations), indicating that CSF1R mutations account for approximately 10% of adult onset leukodystrophies in our cohort. A summary of identified mutations and clinical spectrum is given in table 1. Sequence alignment and in silico pathogenicity predictions for the novel V596M, A763P and E825K mutations are provided in online supplementary figure S1. We did not identify any discriminating clinical feature that could predict whether a CSF1R mutation would be found (see online supplementary table S2 for a summary of the negative cases). Case 1 This patient had struggled at school with learning difficulties and developed sensory symptoms in the limbs at age 25 years. She was involved in a car accident at age 31 years, following which she developed mild cognitive symptoms and executive dysfunction. By age 35 years, there was progressive immobility, cognitive decline and urinary incontinence. Aged 36 years she rapidly deteriorated over a 3-month period, with anarthria, loss of mobility and worsening dementia. Her father had died of motor neuron disease aged 65 years after an 18-month illness. Her mother had been treated for alcoholism and was still alive with a number of physical and cognitive problems. Examination revealed a supranuclear gaze palsy and a brisk jaw jerk. There was an asymmetric spastic quadriparesis and left-sided inattention. She was abulic with a frontal subcortical pattern of cognitive impairment. Mini-Mental State Examination was 8/30. Neuroimaging: The first MRI of the brain at age 31 years was reported as showing an acute parietal infarct with restricted diffusion; however, subsequent imaging showed progressive extensive signal change with patches of restricted diffusion and volume loss in the superficial and deep white matter with relative sparing of the subcortical U fibres (see figure 2). There was disproportionate volume loss and T2-weighted hyperintensity of the splenium of the corpus callosum extending to the posterior limb of both internal capsules and corticospinal tracts at the level of the mid brain. There was no abnormal contrast enhancement and MR angiogram was normal. These imaging findings were thought to be suspicious for cerebral vasculitis. CSF examination, nerve conductions studies and echocardiogram were normal. EEG showed generalised background slowing. A right frontal brain biopsy was performed to investigate the possibility of cerebral vasculitis. Neuropathology (figure 3): Demonstrated well-preserved hexalaminar architecture of the neocortex with no obvious balloon cells (figure 3A). The leptomeninges were unremarkable. In the subcortical white matter, there were frequent eosinophilic axonal swellings, which showed positive labelling for phosphorylated neurofilaments, p62, amyloid precursor protein, amyloid-β (figure 3E, G–I) and ubiquitin. Sparse numbers of PAS and CD68 positive pigmented cells were evident in the white matter (figure 3F, K, L). Immunostaining for GFAP revealed severe reactive stellate and chronic fibrillar astrogliosis in the subcortical white matter and to a lesser extent in the cortex (figure 3B). In spite of frequent axonal spheroids, myelin pallor or significant reduction in density of axons were not apparent (figure 3C, D). There were no α-synuclein (figure 3J), TDP43 or hyperphosphorylated τ positive inclusions in the cortex or white matter, and T lymphocytes and B lymphocytes were very sparse. The patient died suddenly of a massive pulmonary embolus aged 36. Genetic analysis: CSF1R sequencing revealed a novel heterozygous c.1786G>A mutation leading to a V596M substitution in exon 13. Case 2 This patient presented at age 47 years with a 2-year history of depression and personality change, including increasing use of illicit drugs. He made reckless financial decisions and became violent at home. Progressive cognitive deterioration followed and within 2 years of presentation he required long-term care. He developed frequent generalised seizures following a right frontal brain biopsy and gradually became mute and uncommunicative. There was no family history of similar illness. On examination, there was upper limb apraxia and a parkinsonian gait with prominent freezing. Later examination findings included severe rigidity in the left upper limb, a rest tremor and stimulus-sensitive myoclonus. Eye movements were affected by slow saccades, visual impersistance and a mild vertical supranuclear gaze palsy. MRI demonstrated extensive symmetrical T2 high signal in the cerebral white matter involving the frontal, parietal and posterior temporal lobes (figure 2). The lateral and third ventricles were enlarged due to cerebral volume loss. A DaTscan was normal and fluorodeoxyglucose/positron emission tomography scan of the brain demonstrated reduced tracer uptake in the frontal and right parietal lobes. There was no contrast enhancement or diffusion weighted imaging (DWI) positivity and imaging appearances remained stable after 1 year. Neuropathology (figure 4): A right frontal brain biopsy revealed unremarkable leptomeninges and well-preserved hexalaminar cytoarchitecture of the cortex (figure 4A). Myelin pallor and axonal loss (figure 4C, D) were evident in the deeper part of the white matter where frequent axonal spheroids and moderate numbers of pigmented cells were seen. Axonal spheroids contained neurofilaments, amyloid precursor protein and ubiquitin (figure 4E–G). Pigmented cells, which showed yellow-brown colour of the cytoplasm on H&E stained sections, showed positive labelling for CD68 (figure 4H). Immunostainings for hyperphosphorylated τ and α-synuclein were negative and amyloid-β immunoreactivity was restricted to some of the axonal spheroids. Genetic analysis: CSF1R sequencing demonstrated a novel heterozygous c.2287G>A mutation resulting in an A763P substitution in exon 19. Case 3 The patient developed symptoms at age 42 years. The first symptom was impaired balance and unsteadiness when walking and she was referred to a neurologist for investigation of ataxia. Cognitive symptoms developed over the following 9 months with disinhibition, abulia and short-term memory impairment. Urinary incontinence also developed. There was a family history of a similar illness. The patient's mother died at age 42 years with swallowing, memory and walking difficulties. Two maternal uncles were similarly affected. On examination, there was evidence of a global intellectual decline, with frontal and subcortical predominance. There was mild ideomotor and constructional apraxia. There was a postural and action tremor in the limbs with bilateral Gegenhalten. Neuroimaging: MRI revealed gross white matter signal abnormality and cortical volume loss, more significant in the frontal lobe with thinning of the corpus callosum. The lateral ventricles were grossly dilated secondary to cerebral white matter loss. Follow-up MRI 2 years later showed progression of the frontal lobe white matter lesions. There was no contrast enhancement or DWI-positive lesions. Genetic analysis: CSF1R sequencing revealed a novel heterozygous c.2473G>A mutation causing an E825K substitution in exon 19. Case 4 This 45-year-old patient worked as a manager at a hotel and presented with a 1–2-year history of depression and increasing difficulty at work. They had become withdrawn and lost confidence in their ability to solve problems, resulting in being made redundant. The family doctor treated the patient for depression without success. On examination, there was upper limb apraxia and a parkinsonian gait. Cognitive examination revealed significant frontal lobe dysfunction and impaired short-term memory. On examination of eye movements, pursuit was normal but saccades were slow. There was no rigidity in the limbs, myoclonus or dystonia. Neuroimaging: MRI revealed confluent, symmetrical T2 high signal in the frontal and parietal lobes. There was associated atrophy with ventricular dilation and thinning of the corpus callosum. There was relative sparing of the peritrigonal regions. There was no contrast enhancement or DWI-positive lesions. Follow-up imaging 1 year later was unchanged. Genetic analysis: CSF1R sequencing revealed a heterozygous c.2442+1 G>A mutation at a splice site involving exon 18. This mutation has previously been reported to cause HDLS.13 In addition, functional work has shown that mutations at this splice site lead to three aberrant splice variants which exclude exon 18.14 Case 5 This patient developed symptoms at the age of 29 years. Initial symptoms included falls, short-term memory loss and brief, epileptiform episodes with staring and non-responsiveness. They suffered steady cognitive decline during the 30s and by age 40 years was significantly dependent and incontinent with frequent generalised seizures. There was no family history of a similar illness. On examination, the right upper limb was held in a flexed dystonic posture with rigidity. Bilateral grasp reflexes and rooting, suck and pout reflexes were present. Lower limb tone was symmetrically increased with sustained clonus and bilateral extensor plantar responses. There was bilateral tremor, bradykinaesia and a festinating gait. Neuroimaging: MRI showed predominantly anterior periventricular white matter hyperintensities and global cortical atrophy. There was no contrast enhancement or DWI-positive lesions. Follow-up imaging 1 year later was unchanged. Genetic analysis: CSF1R sequencing revealed a heterozygous c.1987G>A mutation causing an E633K substitution in exon 14. This mutation has been reported to cause HDLS previously in a number of reports.13 Discussion CSF1R mutations are part of a small but growing list of microglia-associated neurodegenerative diseases. While early reports suggested that the mutations had a dominant-negative effect, it has now been shown that CSF1R mutations are loss of function. Mutant CSF1R is expressed on the cell surface and can bind CSF1, form dimers and be internalised.15 Therefore, heterozygous mutations result in a 75% reduction in active CSF1/CSF1R dimers that can signal normally. Appropriate CSF1R signalling may be essential not only for CNS development, but also for the health of the fully developed brain. Recently it was shown that microglia in the adult brain are actively dependent on CSF1R signalling. Inhibition of signalling through CSF1R was found to lead to the rapid depletion of almost all brain microglia via apoptosis, with repopulation occurring when inhibition was withdrawn.16 The importance of microglia in maintaining a healthy CNS is increasingly recognised. Interestingly, homozygous mutations in TREM2, another microglial cell surface receptor, cause an early onset dementia, Nasu-Hakola disease.17 Heterozygous variants in TREM2 are also a significant risk factor for Alzheimer's disease (AD),18 and genome-wide association studies have linked variants in the microglial receptors CD33 and IRF8 with AD and multiple sclerosis, respectively.19 ,20 These findings clearly point to the importance of microglia in the health of the CNS and the need to further study how microglial dysfunction leads to neuronal death. In this study, we found that CSF1R mutations account for approximately 10% of adult onset leukodystrophies in a mixed cohort from the UK, Greece and Ireland. We identified a range of phenotypes, with case 1 presenting with features suggesting a CNS vasculitis; cases 2, 4 and 5 had early and late parkinsonian features; and case 3 had a more classical cognitive phenotype. There are at least 30 different leukodystrophies that can present in adulthood, many of which have similar or even indistinguishable presentations making accurate diagnosis challenging.9 Presence of axonal spheroids, pigmented cells and white matter degeneration in diagnostic brain biopsies is highly variable, subject to variable regional predilection for pathology, sampling bias and disease stage. Diagnostic brain biopsies should ideally include full thickness of the cortex and underlying white matter to reduce the sampling bias. In many cases, extensive and expensive testing is required to make a diagnosis. Our study confirms previous findings that CSF1R mutations are a relatively common cause of adult onset leukodystrophy and that CSF1R mutations can lead to diverse phenotypes and can mimic many other neurological diseases, including CNS vasculitis. As the phenotype of CSF1R mutations continues to be refined, we recommend that patients who present with a possible CNS vasculitis or undiagnosed adult onset leukodystrophy be screened early for mutations in CSF1R, and this should not be limited to patients with typical neuropsychiatric or parkinsonian presentations. The early detection of a known pathogenic CSF1R mutation may negate the need for a brain biopsy and its associated risks. Early genetic diagnosis in affected individuals will help guide clinician discussions around prognostication, genetic risk in other family members and reproductive counselling in families. In addition, where a brain biopsy has been performed for a suspected CNS vasculitis and a diagnosis not achieved, the biopsy sample should be carefully examined for the presence of axonal spheroids or pigmented glia and consideration given to CSF1R gene sequencing. Sharing of data and material in this report Genetic data, DNA samples, control data and neuropathological slides are open access for sharing with other research groups.
1850
dbpedia
3
47
https://www.upmc.com/services/heart-vascular/conditions-treatments/hypercholesterolemia
en
Hypercholesterolemia Symptoms and Treatment
https://dam.upmc.com/-/m…88131a9c2748fa9c
https://dam.upmc.com/-/m…88131a9c2748fa9c
[ "https://dam.upmc.com/-/media/upmc/logos/upmclogosvg.svg?rev=8c3ed801ca094f89b30b306f114f6aa1&la=en&hash=368E8BE3E4E116BDC380C30B91DD2C60", "https://dam.upmc.com/-/media/upmc/locations/regions/images/western-pa.jpg?rev=948e8c5ab63143c2b2befae47ea7b297", "https://dam.upmc.com/-/media/upmc/locations/regions/images/central-pa.jpg?rev=de65e72fbc0649608c5d59e8d8a1160d", "https://dam.upmc.com/-/media/upmc/locations/regions/images/north-central-pa.jpg?rev=5a17316b1fc8414291c7de5c13ee2ae6", "https://dam.upmc.com/-/media/upmc/locations/regions/images/maryland.jpg?rev=777285b47caa4cbc81711d0ea88b6ec8", "https://dam.upmc.com/-/media/upmc/locations/regions/images/southwest-pa.png?rev=43703b8d506f477484aa73465f07a0a1", "https://dam.upmc.com/-/media/upmc/locations/regions/images/north-central-pa.jpg?rev=5a17316b1fc8414291c7de5c13ee2ae6", "https://dam.upmc.com/-/media/upmc/locations/regions/images/northwest-pa-ny.png?rev=9b86dc682916424fb2b2e16b72db2179", "https://dam.upmc.com/-/media/upmc/locations/regions/images/west-central-pa.jpg?rev=995692340ad44a6c8d4852880f03d9e0", "https://dam.upmc.com/-/media/upmc/locations/regions/images/central-pa.jpg?rev=de65e72fbc0649608c5d59e8d8a1160d", "https://dam.upmc.com/-/media/upmc/locations/regions/images/maryland.jpg?rev=777285b47caa4cbc81711d0ea88b6ec8", "https://dam.upmc.com/-/media/upmc/locations/regions/images/hospitals.jpg?rev=3e4b0f8fe7794b859a44e0a39d9537dc&la=en&h=250&w=262&hash=D1E6B9839B91D65ADC63EE0540BDD32D", "https://dam.upmc.com/-/media/upmc/locations/regions/images/physical-therapy.jpg?rev=3c81ef48dd5d42f5b5dce2d862d6e81a&la=en&h=250&w=262&hash=B5D7A31674C9E4E7657CF1A7998B6098", "https://dam.upmc.com/-/media/upmc/locations/regions/images/urgent-care.jpg?rev=ce3c93176f464b29b6c0d185b735634c&la=en&h=250&w=262&hash=20ABAE8724F3E1D17BDF83456BED5802", "https://dam.upmc.com/-/media/upmc/locations/regions/images/outpatient-centers.jpg?rev=4755eb1094534fdd8ee747be132ca39b&la=en&h=250&w=262&hash=0054C09BD3368097FCAFDF2A5839E0A5", "https://dam.upmc.com/-/media/upmc/locations/regions/images/imaging.jpg?rev=212458cbe63746878740c7949af30b2a&la=en&h=250&w=262&hash=7398A23B1D48B97B2507CFA3100ABEE5", "https://dam.upmc.com/-/media/upmc/locations/regions/images/community-health-centers.jpg?rev=9d38656391d945a9898996ba7cea711a&la=en&h=250&w=262&hash=6FC1C97178E6174D953D8B494C22E2BF", "https://dam.upmc.com/-/media/upmc/campaigns/coronavirus/hb-banners/blogvariantandvaccine.jpg?rev=e5e7e33e2e614036b5448137b328d02e&la=en&h=250&w=640&hash=8278D7A4363C6C76EE89AA77ED71C259", "https://dam.upmc.com/-/media/upmc/campaigns/coronavirus/hb-banners/blogdeltavariant.jpg?rev=0190e75dada8404fad65583b9ad9e15d&la=en&h=250&w=640&hash=89757419C4EEA58C049F6CE44AADC611", "https://dam.upmc.com/-/media/upmc/logos/upmclogosvg.svg?rev=8c3ed801ca094f89b30b306f114f6aa1&la=en&hash=368E8BE3E4E116BDC380C30B91DD2C60", "https://dam.upmc.com/-/media/upmc/logos/upmclogosvg.svg?rev=8c3ed801ca094f89b30b306f114f6aa1&la=en&hash=368E8BE3E4E116BDC380C30B91DD2C60" ]
[]
[]
[ "" ]
null
[]
null
Learn more about the symptoms, diagnosis, and treatment of hypercholesterolemia at the UPMC Heart and Vascular Institute, located in Pittsburgh.
en
https://dam.upmc.com/-/media/multisite-logos/favicon.ico?rev=44e972153fa34993ab2a81aebc51210b
UPMC | Life Changing Medicine
https://www.upmc.com/services/heart-vascular/conditions-treatments/hypercholesterolemia
What Is Hypercholesterolemia? Hypercholesterolemia is the medical term for high cholesterol. Your body needs some cholesterol to make hormones and digest fatty foods. But too much raises the risk of heart disease and other cardiovascular problems. About 38% of American adults have high cholesterol. There are two main types of cholesterol: LDL, or low-density lipoprotein, carries cholesterol to the cells that need it. But sometimes, there is too much LDL. This causes cholesterol to build up in the artery walls. LDL is often referred to as “bad cholesterol." HDL, or high-density lipoprotein absorbs bad cholesterol. HDL then carries it to the liver and removes it from circulation. HDL is often referred to as "good cholesterol." When you have too much cholesterol, sometimes your body can't remove it. For some people, this is a genetic condition called familial lipid syndrome. Familial high cholesterol affects about 1 in 200 to 250 people around the world. Hypercholesterolemia Causes Common causes of high cholesterol include: Eating a diet high in saturated fat and trans fat, often found in animal meat and processed foods. Eating foods high in cholesterol, such as red meat and full-fat dairy. Certain genetic changes can cause familial hypercholesterolemia. These changes make the body unable to get rid of excess cholesterol, causing it to build up in the blood. People with familial syndrome aren't able to lower cholesterol through diet and exercise alone. Hypercholesterolemia Risk Factors and Complications What you eat and other lifestyle factors play a big role in having high cholesterol. Other risk factors include: Obesity Smoking Type 2 diabetes Age Excess cholesterol builds up in the bloodstream. It collects in the arteries, causing them to get clogged. This makes it harder for blood to flow normally through your body and can lead to heart disease, stroke, or heart attack. Familial high cholesterol can lead to heart disease at a young age. It can also cause deposits of cholesterol under the skin. These look like bumps that can show up around the eyelids or over the hands, knees, or ankles.
1850
dbpedia
0
53
https://www.academia.edu/93052364/Parkinsonian_features_in_hereditary_diffuse_leukoencephalopathy_with_spheroids_HDLS_and_CSF1R_mutations
en
Parkinsonian features in hereditary diffuse leukoencephalopathy with spheroids (HDLS) and CSF1R mutations
http://a.academia-assets.com/images/open-graph-icons/fb-paper.gif
http://a.academia-assets.com/images/open-graph-icons/fb-paper.gif
[ "https://a.academia-assets.com/images/academia-logo-redesign-2015-A.svg", "https://a.academia-assets.com/images/academia-logo-redesign-2015.svg", "https://a.academia-assets.com/images/single_work_splash/adobe.icon.svg", "https://0.academia-photos.com/attachment_thumbnails/95897721/mini_magick20221216-1-vcewsn.png?1671226742", "https://a.academia-assets.com/images/s65_no_pic.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loaders/paper-load.gif", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png", "https://a.academia-assets.com/images/loswp/related-pdf-icon.png" ]
[]
[]
[ "" ]
null
[ "Dennis Dickson", "independent.academia.edu" ]
2022-12-16T00:00:00
Parkinsonian features in hereditary diffuse leukoencephalopathy with spheroids (HDLS) and CSF1R mutations
https://www.academia.edu/93052364/Parkinsonian_features_in_hereditary_diffuse_leukoencephalopathy_with_spheroids_HDLS_and_CSF1R_mutations
Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is a hereditary, adult onset leukodystrophy which is characterised by the presence of axonal loss, axonal spheroids and variably present pigmented macrophages on pathological examination. It most frequently presents in adulthood with dementia and personality change. HDLS has recently been found to be caused by mutations in the colony stimulating factor-1 receptor (CSF1R) gene. In this study, we sequenced the CSF1R gene in a cohort of 48 patients from the UK, Greece and Ireland with adult onset leukodystrophy of unknown cause. Five pathogenic mutations were found, including three novel mutations. The presentations ranged from suspected central nervous system (CNS) vasculitis to extrapyramidal to cognitive phenotypes. The case histories and imaging are presented here, in addition to neuropathological findings from two cases with novel mutations. We estimate that CSF1R mutations account for 10% of idiopathic adult...
1850
dbpedia
1
48
https://www.genome.gov/Genetic-Disorders/Familial-Hypercholesterolemia
en
About Familial Hypercholesterolemia
https://www.genome.gov/s…lesterolemia.jpg
https://www.genome.gov/s…lesterolemia.jpg
[ "https://www.genome.gov/themes/custom/nhgri/assets/global/NHGRI_grey_teal.svg" ]
[]
[]
[ "" ]
null
[ "NHGRI" ]
2019-03-09T00:13:30-05:00
Familial hypercholesterolemia is an inherited condition causing increased low density lipoprotein cholesterol at birth and heart attacks at an early age.
en
/themes/custom/nhgri/favicon.ico
Genome.gov
https://www.genome.gov/Genetic-Disorders/Familial-Hypercholesterolemia
Familial hypercholesterolemia is an inherited condition that causes high levels of LDL (low density lipoprotein) cholesterol beginning at birth, and heart attacks at an early age. Cholesterol is a fat-like substance that is found in the cells of the body. Cholesterol is also found in some foods. The body needs some cholesterol to work properly and uses cholesterol to make hormones, vitamin D, and substances that help with food digestion. However, if too much cholesterol is present in the blood stream, it builds up in the wall of the arteries and increases the risk of heart disease. Cholesterol is carried in the blood stream in small packages called lipoproteins. These small packages are made up of fat (lipid) on the inside and proteins on the outside. There are two main kinds of lipoprotein that carry cholesterol throughout the body. These are: low density lipoprotein (LDL) and high density lipoprotein (HDL). The cholesterol carried by LDL is some times called the "bad cholesterol." People who have familial hypercholesterolemia have high levels of LDL cholesterol because they can not remove the LDL from the blood stream properly. The organ responsible for the removal of the LDL is the liver. High levels of LDL cholesterol in the blood increase the risk for heart attacks and heart disease. The cholesterol carried by HDL is sometimes called the "good cholesterol." HDL carries cholesterol from other parts of the body to the liver. The liver removes cholesterol from the body. Higher levels of HDL cholesterol lower a person's chance for getting heart disease. Men who have familial hypercholesterolemia have heart attacks in their 40's to 50's, and 85 percent of men with the disorder have a heart attack by age 60. Women who have familial hypercholesterolemia also have an increased risk for heart attack, but it happens 10 years later than in men (so in their 50's and 60's). Familial hypercholesterolemia is inherited in families in an autosomal dominant manner. In autosomal dominant inherited conditions, a parent who carries an altered gene that causes the condition has a 1 in 2 (50 percent) chance to pass on that altered gene to each of his or her children. The altered gene (gene mutation) that causes familial hypercholesterolemia is located on chromosome number 19. It contains the information for a protein called LDL receptor that is responsible to clear up LDL from the blood stream. One in 500 individuals carries one altered gene causing familial hypercholesterolemia. These individuals are called heterozygotes. More rarely, a person inherits the gene mutation from both parents, making them genetically homozygous. Individuals who are homozygous have a much more severe form of hypercholesterolemia, with heart attack and death often occurring before age 30. The overall goal of treatment is to lower the risk for atherosclerotic heart disease by lowering the LDL cholesterol levels in the blood stream. Atherosclerosis is a condition in which fatty material collects along the walls of arteries. This fatty material thickens, hardens, and may eventually block the arteries. Atherosclerosis happens when fat and cholesterol and other substances build up in the arteries and form a hardened material called plaque. The plaque deposits make the arteries less flexible and more difficult for blood to flow leading to heart attack and stroke. The first step in treatment for an individual who has heterozygous familial hypercholesterolemia is changing the diet to reduce the total amount of fat eaten to 30 percent of the total daily calories. This can be done by limiting the amount of beef, pork, and lamb in the diet; cutting out butter, whole milk and fatty cheeses as well as some oils like coconut and palm oils; and eliminating egg yolks, organ meats and other sources of saturated fat from animals. Dietary counseling is often recommended to help people to make these changes in their eating habits. Exercise, especially to lose weight, may also help in lowering cholesterol levels. Drug therapy is usually necessary in combination with diet, weight loss, and exercise, as these interventions may not be able to lower cholesterol levels alone. There are a number of cholesterol-lowering medications that are currently used. The first and more effective choice are drugs called "statins." Other drugs that may be used in combination with or instead of the statins are: bile acid sequestrant resins (for example, cholestyramine), ezetemibe, nicotinic acid (niacin), gemfibrozil, and fenofibrate. Individuals who have homozygous familial hypercholesterolemia need more aggressive therapies to treat their significantly elevated levels of cholesterol. Often drug therapies are not sufficient to lower LDL cholesterol levels at the desiderated goal and these individuals may require periodical LDL apheresis, a procedure to "clean up" LDL from the blood stream, or highly invasive surgery such as a liver transplant.
1850
dbpedia
0
3
https://jnnp.bmj.com/content/87/5/512
en
Hereditary leukoencephalopathy with axonal spheroids: a spectrum of phenotypes from CNS vasculitis to parkinsonism in an adult onset leukodystrophy series
https://jnnp.bmj.com/sit…cover-source.jpg
https://jnnp.bmj.com/sit…cover-source.jpg
[ "https://jnnp.bmj.com/sites/default/themes/bmjj/img/logos/logo-bmj-journals.svg", "https://resources.bmj.com/repository/journals-network-project/images/journal-logos/logo-jnnp.svg", "https://jnnp.bmj.com/sites/default/themes/bmjj/img/icon-pdf.png", "https://jnnp.bmj.com/sites/default/themes/bmjj/img/icon-pdf.png", "https://jnnp.bmj.com/sites/all/modules/contrib/panels_ajax_tab/images/loading.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F1.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F1.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F2.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F2.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F3.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F3.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F4.medium.gif", "https://jnnp.bmj.com/content/jnnp/87/5/512/F4.medium.gif" ]
[]
[]
[ "" ]
null
[ "David S Lynch", "Zane Jaunmuktane", "Una-Marie Sheerin", "Rahul Phadke", "Sebastian Brandner", "Ionnis Milonas", "Andrew Dean", "Nin Bajaj", "Nuala McNicholas", "Daniel Costello" ]
2016-05-01T00:00:00
Background Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is a hereditary, adult onset leukodystrophy which is characterised by the presence of axonal loss, axonal spheroids and variably present pigmented macrophages on pathological examination. It most frequently presents in adulthood with dementia and personality change. HDLS has recently been found to be caused by mutations in the colony stimulating factor-1 receptor ( CSF1R ) gene. Methods In this study, we sequenced the CSF1R gene in a cohort of 48 patients from the UK, Greece and Ireland with adult onset leukodystrophy of unknown cause. Results Five pathogenic mutations were found, including three novel mutations. The presentations ranged from suspected central nervous system (CNS) vasculitis to extrapyramidal to cognitive phenotypes. The case histories and imaging are presented here, in addition to neuropathological findings from two cases with novel mutations. Conclusion We estimate that CSF1R mutations account for 10% of idiopathic adult onset leukodystrophies and that genetic testing for CSF1R mutations is essential in adult patients presenting with undefined CNS vasculitis or a leukodystrophy with prominent neuropsychiatric signs or dementia.
en
https://jnnp.bmj.com/sites/default/themes/bmjj/favicon.ico
Journal of Neurology, Neurosurgery & Psychiatry
https://jnnp.bmj.com/content/87/5/512
Introduction Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is an autosomal dominant, adult onset leukodystrophy which typically presents with early onset cognitive or personality change. It is characterised by a distinct neuropathological appearance consisting of axonal loss in the cerebral white matter, axonal spheroids and variably present pigmented microglia. In 2011, it was discovered that heterozygous mutations in the colony stimulating factor-1 receptor (CSF1R) gene cause HDLS.1 In addition, it was shown that pigmented orthochromatic leukodystrophy (POLD) is also caused by CSF1R mutations and that POLD and HDLS exist on a spectrum.2 Previous studies have estimated that CSF1R mutations account between 10% and 25% of adult onset leukodystrophies, depending on the population studied.3 ,4 The clinical phenotype of patients with HDLS is variable, but the most common symptoms include cognitive decline, personality change and depression. Additional symptoms occur frequently and include parkinsonism, spasticity and seizures. Median age of onset is 45 years, although patients with onset as young as 18 have been described. Median life expectancy is 6 years but this is also variable, and some patients have survived for up to 29 years after symptom onset.3 ,5 All mutations identified to date have been found in the tyrosine kinase domain of the protein (exons 12–21) with exons 18, 19 and 20 containing the majority of the mutations (see figure 1 and online supplementary table S1). CSF1R is a cell surface receptor that is highly expressed on cells of the myeloid lineage including the microglia of the central nervous system (CNS).6 It is activated by the cytokines colony stimulating factor-1 (CSF1) and interleukin-34. The receptor consists of an extracellular ligand binding domain, a transmembrane domain and an intracellular tyrosine kinase domain.6 Binding of CSF1 to the CSF1R receptor results in receptor homodimerisation and the autophosphorylation of a number of tyrosine residues in the intracellular domain. This is followed by activation of several signalling pathways including Src,7 AKT, Erk and phospholipase C-γ.8 CSF1R activation therefore regulates microglial survival, proliferation and differentiation. Results We sequenced the CSF1R gene in the 48 patients presenting with adult onset leukodystrophy of unknown cause from the UK, Greece and Ireland and identified five patients carrying mutations in the gene (including 3 novel mutations), indicating that CSF1R mutations account for approximately 10% of adult onset leukodystrophies in our cohort. A summary of identified mutations and clinical spectrum is given in table 1. Sequence alignment and in silico pathogenicity predictions for the novel V596M, A763P and E825K mutations are provided in online supplementary figure S1. We did not identify any discriminating clinical feature that could predict whether a CSF1R mutation would be found (see online supplementary table S2 for a summary of the negative cases). Case 1 This patient had struggled at school with learning difficulties and developed sensory symptoms in the limbs at age 25 years. She was involved in a car accident at age 31 years, following which she developed mild cognitive symptoms and executive dysfunction. By age 35 years, there was progressive immobility, cognitive decline and urinary incontinence. Aged 36 years she rapidly deteriorated over a 3-month period, with anarthria, loss of mobility and worsening dementia. Her father had died of motor neuron disease aged 65 years after an 18-month illness. Her mother had been treated for alcoholism and was still alive with a number of physical and cognitive problems. Examination revealed a supranuclear gaze palsy and a brisk jaw jerk. There was an asymmetric spastic quadriparesis and left-sided inattention. She was abulic with a frontal subcortical pattern of cognitive impairment. Mini-Mental State Examination was 8/30. Neuroimaging: The first MRI of the brain at age 31 years was reported as showing an acute parietal infarct with restricted diffusion; however, subsequent imaging showed progressive extensive signal change with patches of restricted diffusion and volume loss in the superficial and deep white matter with relative sparing of the subcortical U fibres (see figure 2). There was disproportionate volume loss and T2-weighted hyperintensity of the splenium of the corpus callosum extending to the posterior limb of both internal capsules and corticospinal tracts at the level of the mid brain. There was no abnormal contrast enhancement and MR angiogram was normal. These imaging findings were thought to be suspicious for cerebral vasculitis. CSF examination, nerve conductions studies and echocardiogram were normal. EEG showed generalised background slowing. A right frontal brain biopsy was performed to investigate the possibility of cerebral vasculitis. Neuropathology (figure 3): Demonstrated well-preserved hexalaminar architecture of the neocortex with no obvious balloon cells (figure 3A). The leptomeninges were unremarkable. In the subcortical white matter, there were frequent eosinophilic axonal swellings, which showed positive labelling for phosphorylated neurofilaments, p62, amyloid precursor protein, amyloid-β (figure 3E, G–I) and ubiquitin. Sparse numbers of PAS and CD68 positive pigmented cells were evident in the white matter (figure 3F, K, L). Immunostaining for GFAP revealed severe reactive stellate and chronic fibrillar astrogliosis in the subcortical white matter and to a lesser extent in the cortex (figure 3B). In spite of frequent axonal spheroids, myelin pallor or significant reduction in density of axons were not apparent (figure 3C, D). There were no α-synuclein (figure 3J), TDP43 or hyperphosphorylated τ positive inclusions in the cortex or white matter, and T lymphocytes and B lymphocytes were very sparse. The patient died suddenly of a massive pulmonary embolus aged 36. Genetic analysis: CSF1R sequencing revealed a novel heterozygous c.1786G>A mutation leading to a V596M substitution in exon 13. Case 2 This patient presented at age 47 years with a 2-year history of depression and personality change, including increasing use of illicit drugs. He made reckless financial decisions and became violent at home. Progressive cognitive deterioration followed and within 2 years of presentation he required long-term care. He developed frequent generalised seizures following a right frontal brain biopsy and gradually became mute and uncommunicative. There was no family history of similar illness. On examination, there was upper limb apraxia and a parkinsonian gait with prominent freezing. Later examination findings included severe rigidity in the left upper limb, a rest tremor and stimulus-sensitive myoclonus. Eye movements were affected by slow saccades, visual impersistance and a mild vertical supranuclear gaze palsy. MRI demonstrated extensive symmetrical T2 high signal in the cerebral white matter involving the frontal, parietal and posterior temporal lobes (figure 2). The lateral and third ventricles were enlarged due to cerebral volume loss. A DaTscan was normal and fluorodeoxyglucose/positron emission tomography scan of the brain demonstrated reduced tracer uptake in the frontal and right parietal lobes. There was no contrast enhancement or diffusion weighted imaging (DWI) positivity and imaging appearances remained stable after 1 year. Neuropathology (figure 4): A right frontal brain biopsy revealed unremarkable leptomeninges and well-preserved hexalaminar cytoarchitecture of the cortex (figure 4A). Myelin pallor and axonal loss (figure 4C, D) were evident in the deeper part of the white matter where frequent axonal spheroids and moderate numbers of pigmented cells were seen. Axonal spheroids contained neurofilaments, amyloid precursor protein and ubiquitin (figure 4E–G). Pigmented cells, which showed yellow-brown colour of the cytoplasm on H&E stained sections, showed positive labelling for CD68 (figure 4H). Immunostainings for hyperphosphorylated τ and α-synuclein were negative and amyloid-β immunoreactivity was restricted to some of the axonal spheroids. Genetic analysis: CSF1R sequencing demonstrated a novel heterozygous c.2287G>A mutation resulting in an A763P substitution in exon 19. Case 3 The patient developed symptoms at age 42 years. The first symptom was impaired balance and unsteadiness when walking and she was referred to a neurologist for investigation of ataxia. Cognitive symptoms developed over the following 9 months with disinhibition, abulia and short-term memory impairment. Urinary incontinence also developed. There was a family history of a similar illness. The patient's mother died at age 42 years with swallowing, memory and walking difficulties. Two maternal uncles were similarly affected. On examination, there was evidence of a global intellectual decline, with frontal and subcortical predominance. There was mild ideomotor and constructional apraxia. There was a postural and action tremor in the limbs with bilateral Gegenhalten. Neuroimaging: MRI revealed gross white matter signal abnormality and cortical volume loss, more significant in the frontal lobe with thinning of the corpus callosum. The lateral ventricles were grossly dilated secondary to cerebral white matter loss. Follow-up MRI 2 years later showed progression of the frontal lobe white matter lesions. There was no contrast enhancement or DWI-positive lesions. Genetic analysis: CSF1R sequencing revealed a novel heterozygous c.2473G>A mutation causing an E825K substitution in exon 19. Case 4 This 45-year-old patient worked as a manager at a hotel and presented with a 1–2-year history of depression and increasing difficulty at work. They had become withdrawn and lost confidence in their ability to solve problems, resulting in being made redundant. The family doctor treated the patient for depression without success. On examination, there was upper limb apraxia and a parkinsonian gait. Cognitive examination revealed significant frontal lobe dysfunction and impaired short-term memory. On examination of eye movements, pursuit was normal but saccades were slow. There was no rigidity in the limbs, myoclonus or dystonia. Neuroimaging: MRI revealed confluent, symmetrical T2 high signal in the frontal and parietal lobes. There was associated atrophy with ventricular dilation and thinning of the corpus callosum. There was relative sparing of the peritrigonal regions. There was no contrast enhancement or DWI-positive lesions. Follow-up imaging 1 year later was unchanged. Genetic analysis: CSF1R sequencing revealed a heterozygous c.2442+1 G>A mutation at a splice site involving exon 18. This mutation has previously been reported to cause HDLS.13 In addition, functional work has shown that mutations at this splice site lead to three aberrant splice variants which exclude exon 18.14 Case 5 This patient developed symptoms at the age of 29 years. Initial symptoms included falls, short-term memory loss and brief, epileptiform episodes with staring and non-responsiveness. They suffered steady cognitive decline during the 30s and by age 40 years was significantly dependent and incontinent with frequent generalised seizures. There was no family history of a similar illness. On examination, the right upper limb was held in a flexed dystonic posture with rigidity. Bilateral grasp reflexes and rooting, suck and pout reflexes were present. Lower limb tone was symmetrically increased with sustained clonus and bilateral extensor plantar responses. There was bilateral tremor, bradykinaesia and a festinating gait. Neuroimaging: MRI showed predominantly anterior periventricular white matter hyperintensities and global cortical atrophy. There was no contrast enhancement or DWI-positive lesions. Follow-up imaging 1 year later was unchanged. Genetic analysis: CSF1R sequencing revealed a heterozygous c.1987G>A mutation causing an E633K substitution in exon 14. This mutation has been reported to cause HDLS previously in a number of reports.13 Discussion CSF1R mutations are part of a small but growing list of microglia-associated neurodegenerative diseases. While early reports suggested that the mutations had a dominant-negative effect, it has now been shown that CSF1R mutations are loss of function. Mutant CSF1R is expressed on the cell surface and can bind CSF1, form dimers and be internalised.15 Therefore, heterozygous mutations result in a 75% reduction in active CSF1/CSF1R dimers that can signal normally. Appropriate CSF1R signalling may be essential not only for CNS development, but also for the health of the fully developed brain. Recently it was shown that microglia in the adult brain are actively dependent on CSF1R signalling. Inhibition of signalling through CSF1R was found to lead to the rapid depletion of almost all brain microglia via apoptosis, with repopulation occurring when inhibition was withdrawn.16 The importance of microglia in maintaining a healthy CNS is increasingly recognised. Interestingly, homozygous mutations in TREM2, another microglial cell surface receptor, cause an early onset dementia, Nasu-Hakola disease.17 Heterozygous variants in TREM2 are also a significant risk factor for Alzheimer's disease (AD),18 and genome-wide association studies have linked variants in the microglial receptors CD33 and IRF8 with AD and multiple sclerosis, respectively.19 ,20 These findings clearly point to the importance of microglia in the health of the CNS and the need to further study how microglial dysfunction leads to neuronal death. In this study, we found that CSF1R mutations account for approximately 10% of adult onset leukodystrophies in a mixed cohort from the UK, Greece and Ireland. We identified a range of phenotypes, with case 1 presenting with features suggesting a CNS vasculitis; cases 2, 4 and 5 had early and late parkinsonian features; and case 3 had a more classical cognitive phenotype. There are at least 30 different leukodystrophies that can present in adulthood, many of which have similar or even indistinguishable presentations making accurate diagnosis challenging.9 Presence of axonal spheroids, pigmented cells and white matter degeneration in diagnostic brain biopsies is highly variable, subject to variable regional predilection for pathology, sampling bias and disease stage. Diagnostic brain biopsies should ideally include full thickness of the cortex and underlying white matter to reduce the sampling bias. In many cases, extensive and expensive testing is required to make a diagnosis. Our study confirms previous findings that CSF1R mutations are a relatively common cause of adult onset leukodystrophy and that CSF1R mutations can lead to diverse phenotypes and can mimic many other neurological diseases, including CNS vasculitis. As the phenotype of CSF1R mutations continues to be refined, we recommend that patients who present with a possible CNS vasculitis or undiagnosed adult onset leukodystrophy be screened early for mutations in CSF1R, and this should not be limited to patients with typical neuropsychiatric or parkinsonian presentations. The early detection of a known pathogenic CSF1R mutation may negate the need for a brain biopsy and its associated risks. Early genetic diagnosis in affected individuals will help guide clinician discussions around prognostication, genetic risk in other family members and reproductive counselling in families. In addition, where a brain biopsy has been performed for a suspected CNS vasculitis and a diagnosis not achieved, the biopsy sample should be carefully examined for the presence of axonal spheroids or pigmented glia and consideration given to CSF1R gene sequencing. Sharing of data and material in this report Genetic data, DNA samples, control data and neuropathological slides are open access for sharing with other research groups.
1850
dbpedia
2
89
https://uis.brage.unit.no/uis-xmlui/handle/11250/2999548%3Flocale-attribute%3Dno
en
UiS Brage: Metabolic flux analysis of 3D spheroids reveals significant differences in glucose metabolism from matched 2D cultures of colorectal cancer and pancreatic ductal adenocarcinoma cell lines
[ "https://uis.brage.unit.no/uis-xmlui/bitstream/handle/11250/2999548/s40170-022-00285-w.pdf.jpg?sequence=6&isAllowed=y", "https://uis.brage.unit.no/uis-xmlui/themes/Mirage2//images/creativecommons/cc-by.png", "https://uis.brage.unit.no/uis-xmlui/themes/Mirage2/images/unit_product.png", "https://uis.brage.unit.no/uis-xmlui/themes/Mirage2/images/unit_product.png" ]
[]
[]
[ "" ]
null
[ "Hanne Røland", "Tia R", "Gro Vatne", "Karl Johan" ]
null
en
/uis-xmlui/themes/Mirage2/images/favicon.ico
null
1850
dbpedia
3
8
https://www.webmd.com/cholesterol-management/good-cholesterol-too-high
en
Can High Levels of Good Cholesterol Be Bad for You?
https://img.lb.wbmdstati…ebmd-logo-fb.jpg
https://img.lb.wbmdstati…ebmd-logo-fb.jpg
[ "https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/logos/webmd/web/webmd_logo_white.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg", "https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/library_books.2bf509db.svg", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/articles/biographies/sheikh_zilpah_382x382.jpg?resize=51px:51px&output-quality=75", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/articles/health_tools/rise_above_and_thrive_with_rheumatoid_arthritis_slideshow/1800ss_getty_rf_clinical_researcher.jpg?resize=750:*", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/more_on/MoreOn_Migraine.jpg?resize=300px:*&output-quality=75", "https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/recommended/cholesterol-recommended-5.jpg?resize=500px:*&output-quality=75", "https://privacy-policy.truste.com/privacy-seal/seal?rid=07326333-3522-463d-81bf-f00fd7171fff", "https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/layout/shared/tag-registered.png?resize=*:60px", "https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/oncology/1/footer-images/ad-choice.png", "https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/oncology/1/images/webmd-logo-white.svg", "https://sb/p?c1=2&c2=6035829&cv=3.9.1&cj=1" ]
[]
[]
[ "" ]
null
[ "Stephanie Watson", "www.facebook.com" ]
2021-06-14T08:00:00
Experts tell us to boost our HDL level, but very high levels of this "good" type of cholesterol could increase heart disease risk.
en
https://img.lb.wbmdstati…icon/favicon.png
WebMD
https://www.webmd.com/cholesterol-management/good-cholesterol-too-high
What Is Good Cholesterol? There are two types of cholesterol, the waxy substance found in your blood. Low-density lipoprotein (LDL) cholesterol is considered "bad" cholesterol because it can build up inside your arteries and lead to heart attacks and strokes. The high-density lipoprotein (HDL) type is often called "good cholesterol" because it helps your body get rid of excess LDL cholesterol. When a doctor does a lipid panel test to check your cholesterol levels, they look at both types of cholesterol. Health experts say that men (and those identified as male at birth) should aim for an HDL level of 40 to 60 milligrams (mg) per deciliter (dL) to protect against heart disease and stroke. Women, and those identified as female at birth, should aim for 50 to 60 mg/dL. When there's more LDL cholesterol in your blood than your body needs, good cholesterol sweeps it back into to your liver. It's then broken down and removed from your body in your poop. In general, good cholesterol also: Reduces inflammation Protects cells and tissues from damage due to oxidation Is involved in preventing blood clots You might think that if high levels of good cholesterol are healthy, higher numbers would be even better. But the effects of HDL cholesterol are more complicated than experts once thought. And it's possible to have too much. Effects of High Good Cholesterol Levels Very high HDL cholesterol levels don't give you more protection. Even moderately high levels may not protect you if you have certain health issues or unhealthy lifestyle habits. The good cholesterol can start to act like bad cholesterol and increase your risk of disease in your heart and blood vessels. According to research into HDL cholesterol: One large study found that people with "good cholesterol" levels above 60 mg/dL were nearly 50% more likely to have a heart attack or die from heart disease than people whose HDL levels were between 41 and 60 mg/dL. During the course of another study, people with very high levels of HDL (more than 80 mg/dL for men or 100 mg/dL for women) were at higher risk of dying from problems with their heart and blood vessels and all other causes. In people who'd had heart attacks and had high blood levels of proteins that signal inflammation, HDL levels over 60 mg/dL increased the risk for further issues with their heart and blood vessels. Older people with HDL cholesterol levels over 80 mg/dL were found to have a 27% higher risk of dementia. Why might good cholesterol turn harmful at very high levels or under certain circumstances? Researchers don't know for sure, but they have some ideas. In some cases, such as when you have system-wide inflammation or other conditions, like diseases of your heart and blood vessels, HDL cholesterol could actually slow down the process of clearing LDL cholesterol from your arteries. When LDL cholesterol builds up in these blood vessels, it forms clumps called plaques that slow or block blood flow. Eventually, a chunk of plaque can break free and form a clot, which could lead to a heart attack or stroke. Too much HDL might also increase inflammation and oxidation related to these plaques. What Causes High HDL Levels? A few things can push your HDL level above 60 mg/dL. You can control some of these things but not all of them. Your genes Certain genes make you more likely to have high HDL cholesterol. Inherited high HDL sometimes protects against heart disease, but sometimes it increases the risk. For example, people with a change in the gene SCARB1 have larger-than-normal HDL cholesterol particles in their blood that increase their heart disease risk. Some people of Japanese descent inherit genes that make them produce too little of the protein CETP, which helps carry cholesterol around the body. Having low CETP leads to high HDL levels in your blood, but it doesn't seem to increase the risk of heart disease. Certain inherited conditions, like familial hyperalphalipoproteinemia and cholesteryl ester transfer protein (CETP) deficiency, also cause very high levels of good cholesterol. If you have high HDL and close relatives like your parents or siblings have had heart disease, a heart attack, or a stroke, your doctor might send you to a genetic counselor or heart doctor for more testing. Your diet Foods that are high in unsaturated fats, such as fish, nuts, and green leafy vegetables , raise HDL in a good way. But just as they raise bad cholesterol, diets high in saturated fats can increase good cholesterol too much or make it less protective. Foods high in saturated fat include: Red meat Cream and other full-fat dairy products Butter Cheese Cookies, cakes, and other baked goods Fried foods Excess alcohol consumption Drinking alcohol tends to increase HDL, which can be a good thing in moderation.  But having more than about two drinks a day could raise your HDL beyond healthy levels or cause it to work differently in your body. It increases LDL levels as well. That puts you at higher risk of high blood pressure, strokes, and heart attacks. Medications Medicines like these can increase HDL levels: Statin drugs and other medications you take to lower LDL cholesterol and triglycerides Birth control pills Hormone replacement therapy for menopause Drugs to prevent seizures Corticosteroids Insulin High doses of niacin Menopause While “the change” doesn’t cause a spike in HDL, it does make this good cholesterol less good. Early in life, women tend to have higher HDL than men, which protects them from heart disease. The female hormone, estrogen, seems to boost HDL levels. Lower estrogen levels after menopause change the way HDL cholesterol works in the body, making it less protective against heart disease. Treating High HDL Cholesterol If you don't have any symptoms or other heart disease risks, you may not need any treatment for high HDL cholesterol. Your doctor will try to figure out what's causing it and find out if it needs to be treated. If you have high overall cholesterol,  the standard treatment is to lower LDL cholesterol. No medications are approved to reduce HDL cholesterol You may be able to lower yours by drinking less alcohol and eating a low-fat diet. It might also help to change your medication if you take a statin or another drug that raises HDL levels. Stay on top of your cholesterol levels with regular blood tests. Ask your doctor how often you need cholesterol screening based on your risks.  How Often to Test Your Good Cholesterol Levels How often you need to have your cholesterol levels checked depends on your age, your overall health, your health history, and whether you have risk factors for heart disease. In general, doctors recommend lipid panels: Yearly for people over 65 Every 1-2 years for men (and those identified as male at birth) ages 45-65 and women (and those identified as female at birth) ages 55-65 Every 5 years for younger people. Testing should start at age 9-11 for most children, and as early as age 2 for those with family histories of heart attack, stroke, or high cholesterol.  Takeaways High-density lipoprotein (HDL) cholesterol is often called “good cholesterol” because it helps your body get rid of extra cholesterol. But if your HDL cholesterol levels are very high or you have certain other health conditions, it can lose its protective effects. Talk to your doctor about whether your HDL and overall cholesterol levels are where they should be.  Good Cholesterol FAQs What are good HDL and LDL levels? For males (and those assigned male at birth) ages 20 and up, doctors generally recommend these ranges: Total cholesterol: 125-200 mg/dL LDL cholesterol: Less than 100 mg/dL HDL cholesterol: 40 mg/dL or higher For women (and those assigned female at birth) ages 20 and older: Total cholesterol: 125-200 mg/dL LDL cholesterol: Less than 100 mg/dL HDL cholesterol: 50 mg/dL or higher Why does exercise increase HDL cholesterol? If you're trying to boost your good cholesterol levels, cardio exercise can help. Try to work out at least 5 days a week for at least 30 minutes at a time. Experts don't know exactly how it works, but it's thought to increase the activity of a substance called lipoprotein lipase in your muscles. Lipoprotein lipase is involved in breaking down fats in your body. What is an alarmingly high good cholesterol level? HDL cholesterol levels of 80 or more mg/dL are considered high no matter what your gender. But how much HDL cholesterol you have may not matter as much as the way it acts in your body.
1850
dbpedia
1
72
https://www.nytimes.com/2012/05/17/health/research/hdl-good-cholesterol-found-not-to-cut-heart-risk.html
en
HDL ‘Good Cholesterol’ Found Not to Cut Heart Risk
https://static01.nyt.com…op.png?year=2012
https://static01.nyt.com…op.png?year=2012
[]
[]
[]
[ "" ]
null
[ "Gina Kolata" ]
2012-05-17T00:00:00
People genetically prone to higher levels of HDL, often called “good cholesterol,” showed that they did not have any significant decrease in risk of cardiovascular disease.
en
/vi-assets/static-assets/favicon-d2483f10ef688e6f89e23806b9700298.ico
https://www.nytimes.com/2012/05/17/health/research/hdl-good-cholesterol-found-not-to-cut-heart-risk.html
The name alone sounds so encouraging: HDL, the “good cholesterol.” The more of it in your blood, the lower your risk of heart disease. So bringing up HDL levels has got to be good for health. Or so the theory went. Now, a new study that makes use of powerful databases of genetic information has found that raising HDL levels may not make any difference to heart disease risk. People who inherit genes that give them naturally higher HDL levels throughout life have no less heart disease than those who inherit genes that give them slightly lower levels. If HDL were protective, those with genes causing higher levels should have had less heart disease. Researchers not associated with the study, published online Wednesday in The Lancet, found the results compelling and disturbing. Companies are actively developing and testing drugs that raise HDL, although three recent studies of such treatments have failed. And patients with low HDL levels are often told to try to raise them by exercising or dieting or even by taking niacin, which raised HDL but failed to lower heart disease risk in a recent clinical trial. “I’d say the HDL hypothesis is on the ropes right now,” said Dr. James A. de Lemos, a professor at the University of Texas Southwestern Medical Center, who was not involved in the study. Dr. Michael Lauer, director of the division of cardiovascular sciences at the National Heart, Lung and Blood Institute, agreed. “The current study tells us that when it comes to HDL we should seriously consider going back to the drawing board, in this case meaning back to the laboratory,” said Dr. Lauer, who also was not connected to the research. “We need to encourage basic laboratory scientists to figure out where HDL fits in the puzzle — just what exactly is it a marker for.” Thank you for your patience while we verify access. If you are in Reader mode please exit and log into your Times account, or subscribe for all of The Times. Thank you for your patience while we verify access. Already a subscriber? Log in. Want all of The Times? Subscribe.
1850
dbpedia
1
25
https://www.everydayhealth.com/high-cholesterol/treatment/10-things-you-need-to-know-about-inherited-high-cholesterol/
en
9 Things You Need to Know About Inherited High Cholesterol
https://images.everydayh…fvrsn=7c54ded6_1
https://images.everydayh…fvrsn=7c54ded6_1
[ "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/site-images/01-health-conditions-a-z.png?sfvrsn=909a1558_1", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/site-images/02-wellness-and-self-care.png?sfvrsn=7d17ab8c_1", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/news/link-heme-iron-red-meat-diabetes-risk-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/senior-health/dementia/can-coffee-tea-protect-against-dementia-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/news/fda-approves-zoryve-for-atopic-dermatitis-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/site-images/05-product-reviews.png?sfvrsn=757fb46a_1", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/site-images/06-find-a-doctor.png?sfvrsn=ff47e990_1", "https://images.everydayhealth.com/images/bio-photos/zachary-smith-bio021c3129b9964cb88d6af2c12b440452.jpg?w=48&h=48", "https://images.everydayhealth.com/images/bio-photos/anurag-sahu-bio.jpeg?w=48&h=48", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/things-you-need-to-know-about-inherited-high-cholesterol-1440x810.jpg?sfvrsn=7c54ded6_3", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/newsletter-signup/nl-heart-health-1920x1080.jpg?sfvrsn=51efb161_2", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/cs-whats-causing-your-high-triglycerides_-6-culprits-that-may-surprise-you-alt-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/news/finasteride-may-cut-heart-disease-risk-in-men-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/faqs-about-high-cholesterol-treatment-answered-alt-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/cs-common-cholesterol-mistakes-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/dining-out-when-you-have-high-cholesterol-alt-1-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/how-exercise-can-lower-bad-cholesterol-alt-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/news/risks-of-high-blood-pressure-cholesterol-before-55-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/cs-how-to-eat-vegetarian-when-you-have-high-cholesterol-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/cs-how-doctors-treat-high-triglycerides-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/images/heart-health/high-cholesterol/cs-top-questions-about-high-cholesterol-answered-1440x810.jpg", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/react-component-images/everydayhealthgrouplogo-long-white.png?w=120", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://images.everydayhealth.com/react-component-images/adchoices-no-border.png", "https://images.everydayhealth.com/react-component-images/image-src-placeholder-16x9288625876.png", "https://privacy-policy.truste.com/privacy-seal/seal?rid=01b0263e-277d-4e52-9ddd-86550128ec1a" ]
[]
[]
[ "" ]
null
[ "Zachary Smith", "Anurag Sahu" ]
2024-08-01T00:00:00
For some, high cholesterol runs in the family — which many won’t know if they don’t have symptoms. Here is everything you need to know about who is at risk, what the signs are, and how to treat inherited high cholesterol, also known as familial hypercholesterolemia or FH.
en
//images.everydayhealth.com/images/site-images/favicon.png
EverydayHealth.com
https://www.everydayhealth.com/high-cholesterol/treatment/10-things-you-need-to-know-about-inherited-high-cholesterol/
FH Plays a Trick on the Liver FH is caused by faulty LDL receptors that can’t cycle cholesterol from the bloodstream through the liver. But that’s only part of the problem. FH convinces the liver that the body isn’t getting any cholesterol, which forces the liver to manufacture more of its own cholesterol and signals to the intestine to absorb more cholesterol than it usually would because of this perceived scarcity. This makes it extremely difficult for people with FH to get their cholesterol down. No amount of diet, exercise, or good lifestyle choices can stop the liver from producing more cholesterol. It’s a Family Affair If a parent has familial hypercholesterolemia, there is a 50 percent chance a child will inherit the LDL abnormality, known as heterozygous FH. In rare cases, if both parents have FH, there is a 25 percent chance the child will inherit the FH gene from both of them, known as homozygous FH, the most severe case of high cholesterol, which can develop into heart disease as early as the preteen years. Cardiologists can perform cascade screenings to reduce guesswork, which means they screen all the first-degree relatives of their initial FH patient. “I think about my patients with the most severe form of this disorder. I know how many kids they all have,” says James Underberg, MD, a clinical assistant professor at the NYU Grossman School of Medicine in New York City and the president of the National Lipid Association. “I'm taking care of their family by keeping the patient healthy,” Dr. Underberg explains. “I'm taking care of the kids who may also have the disorder. We tend to take care of families of patients.” Symptoms Are Few and Mild Most people don’t have FH symptoms, which makes going undiagnosed so dangerous. But some people have cholesterol deposits that develop into small bumps around their eyes or tendons. Some people younger than 45 may also notice a white ring around the eye's cornea, known as a corneal arcus. Typically, it appears as a half-moon on the bottom or top of the cornea, which means you can miss it if it's hidden by your eyelid. Dr. Cho says the best way to determine if you should get tested is simply to evaluate your family’s history with cholesterol. More People Have FH Than You Think More than a third of the population has high cholesterol, according to the CDC, and about 1 in 200 adults are affected by FH in the general population. That means about 1.3 million people in the United States have FH, including children. FH is frequently diagnosed in insular communities, such as Ashkenazi Jews, Dutch Afrikaners, and French Canadians, who have a greater chance of passing FH among themselves. Underberg says that FH does not affect any particular race, ethnicity, or gender differently from any other. But in a review published in Circulation in May 2020, researchers found that 60 percent of studies and over 80 percent of reported FH cases are from Europe, with no representation from Southeast Asia and Africa, suggesting that further research is needed on racial disparity. Undiagnosed FH Can Mean Early Heart Disease for Some If left undiagnosed and untreated, people with FH have a 20 times greater risk of developing heart disease, according to the American Heart Association. Patients are also susceptible to peripheral vascular disease and stroke much earlier than the general population. Half of the men with untreated FH will have a heart attack before turning 50, and may have one as early as their twenties. Coronary heart disease in women can appear up to 30 years earlier than usual, and 30 percent of untreated women will have a heart attack before they turn 60, according to the American Heart Association. FH Is Treatable While a healthy lifestyle cannot fix familial hypercholesterolemia alone, it is still strongly encouraged. This means following a low-fat diet like the Mediterranean diet or a plant-based diet, and getting about 30 minutes a day of moderate exercise such as brisk walking, running, cycling, or any activity that you enjoy and keeps you moving. It also means ditching bad habits like smoking or drinking too much alcohol. Statin medications are another layer of treatment for FH. These include PCSK9 inhibitors like Praluent, which lower total cholesterol; ezetimibe (Zetia), which decreases cholesterol absorption in the intestine; and bile acid sequestrants like cholestyramine or colestipol, which lower LDL cholesterol. Another class of drugs that work by blocking the production of cholesterol in the liver are adenosine triphosphate-citrate lyase (ACL) inhibitors. These are used as a primary prevention of high cholesterol in individuals with heterozygous FH. Bempedoic acid (Nexletol) is the only ACL inhibitor approved by the U.S. Food and Drug Administration (FDA) for reducing LDL cholesterol in this population. But cholesterol in some individuals can be so high that medication doesn’t work. For them, a nonsurgical therapy called LDL apheresis can be performed every two weeks to remove cholesterol from the blood, similar to dialysis. A study in the July 2018 Frontiers in Pharmacology identified 14 treatment options for FH ranging from diet to fish oils to genetic therapy. It also found that both children and adults should receive similar treatments. Ultimately, for most people with FH, treatment is some combination of “all of the above.” “Lifestyle and exercise are good not just for the heart, but it's good for your whole life,” says Cho. “Just because you're taking cholesterol medicine doesn't mean you are done and you can eat whatever the heck you want. Your body is all one connected thing.” It’s Okay to Treat Young Children Often, medical treatment is a last resort for children with any condition. But for FH, the earlier treatment happens, the better. A review published in the Journal of the American Heart Association found that universal lipid screening is recommended in children as early as age 2 for families with a history of high cholesterol and screenings around ages 9 to 11 for everyone else. But only one-third of practicing pediatricians have adopted these recommendations, even though earlier detection means a smaller chance people with FH will need to rely on medication and therapies. The study found that statins are effective and FDA-approved for children in need of more advanced treatment. Pravastatin and pitavastatin are approved for children age 8 and older, whereas the five other statins on the market are FDA-approved from the age of 10. Underberg says early diagnosis and treatment are akin to getting a car to a mechanic right away instead of waiting for it to break down. “It's the same with cholesterol management in these patients,” says Underberg. “If you treat it when the kids are young, you reduce the risk early in life so aggressively that later in life, you don't have to do as much.” We Know More Now About FH Than Ever Before Reputable sources like the American Heart Association and advocacy groups like the Family Heart Foundation and Underberg’s National Lipid Association are committed to informing and studying FH through continuing research, which has already pushed the limits of what we know much further than before. “I would tell you the last 10 years has really been a boom time for awareness around FH, and part of it is because of the emergence of new therapeutics,” says Underberg. “In my lifetime, I've seen this disease go from something that could kill you by the age of 15 to something where you can expect to live a lifetime if treated early and appropriately.”
1850
dbpedia
2
71
https://researchportal.lih.lu/en/publications/comprehensive-diagnostics-in-a-case-of-hereditary-diffuse-leukody
en
Comprehensive diagnostics in a case of hereditary diffuse leukodystrophy with spheroids
https://researchportal.lih.lu/skin/headerImage/
https://researchportal.lih.lu/skin/headerImage/
[ "https://researchportal.lih.lu/skin/headerImage/" ]
[]
[]
[ "" ]
null
[ "Marie Meyer-Ohlendorf", "Anne Braczynski", "Omar Al-Qaisi", "Florian Gessler", "Saskia Biskup", "Lutz Weise", "Joachim P. Steinbach", "Marlies Wagner", "Michel Mittelbronn", "Oliver Bähr" ]
null
en
Luxembourg Institute of Health
https://researchportal.lih.lu/en/publications/comprehensive-diagnostics-in-a-case-of-hereditary-diffuse-leukody
Background: Hereditary diffuse leukodystrophy with spheroids is a rare type of leukoencephalopathy. Mutations in the colony stimulating factor 1 receptor have recently been identified to be the cause of this microgliopathy. Clinical and radiological presentation can often misguide physicians during the diagnosis of patients with this underdiagnosed disease. Case presentation: We present a 29year-old woman with a rapid course of hereditary diffuse leukodystrophy with spheroids. She mainly showed cognitive impairment and severe motor dysfunctions. Her MRI showed spotted and confluent hyperintensities of the white matter on T2-weighted images involving the corticospinal tract as well as the corpus callosum. Further, those lesions showed striking restricted diffusion. As this restricted diffusion in all areas showing signs of leukoencephalopathy was so impressive we searched Medline for these terms and got hereditary diffuse leukodystrophy with spheroids as one of the first results. After a comprehensive diagnostic workup and exclusion of other leukoencephalopathies, stereotactic biopsy and genetic testing confirmed the diagnosis. Conclusion: This case points out at two important features of hereditary diffuse leukodystrophy with spheroids being spotted and/or confluent leukoencephalopathy with areas of restricted diffusion. This might help to identify more patients with this underdiagnosed disease. Moreover, the rapid clinical course in our patient raises the question whether the relatively pronounced areas of restricted diffusion are indicative of a more acute progression of the disease. TY - JOUR T1 - Comprehensive diagnostics in a case of hereditary diffuse leukodystrophy with spheroids AU - Meyer-Ohlendorf, Marie AU - Braczynski, Anne AU - Al-Qaisi, Omar AU - Gessler, Florian AU - Biskup, Saskia AU - Weise, Lutz AU - Steinbach, Joachim P. AU - Wagner, Marlies AU - Mittelbronn, Michel AU - Bähr, Oliver N1 - Publisher Copyright: © 2015 Meyer-Ohlendorf et al. PY - 2015/7/4 Y1 - 2015/7/4 N2 - Background: Hereditary diffuse leukodystrophy with spheroids is a rare type of leukoencephalopathy. Mutations in the colony stimulating factor 1 receptor have recently been identified to be the cause of this microgliopathy. Clinical and radiological presentation can often misguide physicians during the diagnosis of patients with this underdiagnosed disease. Case presentation: We present a 29year-old woman with a rapid course of hereditary diffuse leukodystrophy with spheroids. She mainly showed cognitive impairment and severe motor dysfunctions. Her MRI showed spotted and confluent hyperintensities of the white matter on T2-weighted images involving the corticospinal tract as well as the corpus callosum. Further, those lesions showed striking restricted diffusion. As this restricted diffusion in all areas showing signs of leukoencephalopathy was so impressive we searched Medline for these terms and got hereditary diffuse leukodystrophy with spheroids as one of the first results. After a comprehensive diagnostic workup and exclusion of other leukoencephalopathies, stereotactic biopsy and genetic testing confirmed the diagnosis. Conclusion: This case points out at two important features of hereditary diffuse leukodystrophy with spheroids being spotted and/or confluent leukoencephalopathy with areas of restricted diffusion. This might help to identify more patients with this underdiagnosed disease. Moreover, the rapid clinical course in our patient raises the question whether the relatively pronounced areas of restricted diffusion are indicative of a more acute progression of the disease. AB - Background: Hereditary diffuse leukodystrophy with spheroids is a rare type of leukoencephalopathy. Mutations in the colony stimulating factor 1 receptor have recently been identified to be the cause of this microgliopathy. Clinical and radiological presentation can often misguide physicians during the diagnosis of patients with this underdiagnosed disease. Case presentation: We present a 29year-old woman with a rapid course of hereditary diffuse leukodystrophy with spheroids. She mainly showed cognitive impairment and severe motor dysfunctions. Her MRI showed spotted and confluent hyperintensities of the white matter on T2-weighted images involving the corticospinal tract as well as the corpus callosum. Further, those lesions showed striking restricted diffusion. As this restricted diffusion in all areas showing signs of leukoencephalopathy was so impressive we searched Medline for these terms and got hereditary diffuse leukodystrophy with spheroids as one of the first results. After a comprehensive diagnostic workup and exclusion of other leukoencephalopathies, stereotactic biopsy and genetic testing confirmed the diagnosis. Conclusion: This case points out at two important features of hereditary diffuse leukodystrophy with spheroids being spotted and/or confluent leukoencephalopathy with areas of restricted diffusion. This might help to identify more patients with this underdiagnosed disease. Moreover, the rapid clinical course in our patient raises the question whether the relatively pronounced areas of restricted diffusion are indicative of a more acute progression of the disease. KW - ADC KW - CSF1R KW - DWI KW - Electron microscopy KW - HDLS KW - Leukoencephalopathy KW - MR spectroscopy KW - Restricted diffusion UR - http://www.scopus.com/inward/record.url?scp=84936865054&partnerID=8YFLogxK U2 - 10.1186/s12883-015-0368-3 DO - 10.1186/s12883-015-0368-3 M3 - Article C2 - 26141177 AN - SCOPUS:84936865054 SN - 1471-2377 VL - 15 JO - BMC Neurology JF - BMC Neurology IS - 1 M1 - 103 ER -
1850
dbpedia
1
73
https://www.nhs.uk/conditions/high-cholesterol/
en
High cholesterol
https://www.nhs.uk/stati…a74435697f45.png
https://www.nhs.uk/stati…a74435697f45.png
[]
[]
[]
[ "" ]
null
[ "NHS website", "www.facebook.com" ]
2017-10-23T10:47:00
Find out what cholesterol is, what causes high cholesterol, why it's important to keep your cholesterol levels under control, and how to lower your cholesterol.
en
/static/nhsuk/img/favicons/favicon.68c7f017cfba.ico
nhs.uk
https://www.nhs.uk/conditions/high-cholesterol/
What is high cholesterol? High cholesterol is when you have too much of a fatty substance called cholesterol in your blood. It's mainly caused by eating fatty food, not exercising enough, being overweight, smoking and drinking alcohol. It can also run in families. You can lower your cholesterol by eating healthily and getting more exercise. Some people also need to take medicine. Too much cholesterol can block your blood vessels. It makes you more likely to have heart problems or a stroke. High cholesterol does not usually cause symptoms. You can only find out if you have it from a blood test. Information: Heart UK has separate information about inherited high cholesterol that starts at a young age (familial hypercholesterolaemia). Find out about familial hypercholesterolaemia on the Heart UK website Page last reviewed: 13 July 2022 Next review due: 13 July 2025
1850
dbpedia
2
67
https://biblio.ugent.be/publication/01HS18P75V7B4P8F8J4D8QVE5H
en
Chronic exposure to dietary compounds shifts bioenergetics in colorectal cancer
https://biblio.ugent.be/favicon.ico
https://biblio.ugent.be/favicon.ico
[ "https://biblio.ugent.be/static/images/logo_ugent_nl.svg", "https://biblio.ugent.be/static/images/publication-blank.png" ]
[]
[]
[ "" ]
null
[ "Elien Alderweireldt ( UGent )", "Charlotte Grootaert ( UGent )", "Andreja Rajkovic ( UGent )", "Filip Van Nieuwerburgh ( UGent )", "John Van Camp ( UGent )", "Van Nieuwerburgh", "Van Camp", "De Wever" ]
2023-08-19T00:00:00
nl
/favicon.ico
https://biblio.ugent.be/publication/01HS18P75V7B4P8F8J4D8QVE5H
@inproceedings{01HS18P75V7B4P8F8J4D8QVE5H, abstract = {{Nutritional availability in the colonic microenvironment, influenced by dietary habits and further diversified by gut microorganisms, affects the energetic options of colorectal cancer (CRC) cells. Moreover, specific compounds may alter their metabolic flexibility, defined as the ability to adapt to nutritional changes, and a required feature for cancer cell invasion and spreading. Therefore, the aim of this study was to characterize the metabolic behavior of 3D CRC spheroids in different nutritional contexts. A long-term-subtoxic-dose experimental set-up was developed to provide insights in (i) the chronic effects of exposure to dietary metabolites, and (ii) the impact of media types with different nutrient-richness. Using extracellular flux analysis and RNA Illumina sequencing, we demonstrated that the access to glucose, glutamine, pyruvate and/or butyrate dictates the metabolic profile of CRC spheroids, who display high levels of both glycolysis and mitochondrial respiration. Moreover, the chronic pretreatment with dietary metabolites changed the preferred energetic routes and the response of CRC cells to a shift in nutrient-richness, suggesting an impact on their metabolic adaptability. These results show that chronic exposure to dietary compounds can affect the bioenergetics of CRC spheroids, and underscore the importance of culture medium composition, choice of cell line, and time of exposure in nutritional and metabolic research.}}, author = {{Alderweireldt, Elien and Grootaert, Charlotte and Rajkovic, Andreja and Van Nieuwerburgh, Filip and Van Camp, John and De Wever, Olivier}}, booktitle = {{Ghent Gut Inflammation Group, 4th Meeting, Abstracts}}, language = {{eng}}, location = {{Ghent, Belgium}}, pages = {{1}}, title = {{Chronic exposure to dietary compounds shifts bioenergetics in colorectal cancer}}, year = {{2023}}, }
1850
dbpedia
0
2
https://ulf.org/leukodystrophies/hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
en
Hereditary Diffuse Leukoencephalopathy with Spheroids (HDLS)
https://0zv8e8.a2cdn1.se…ystrophies-1.png
https://0zv8e8.a2cdn1.se…ystrophies-1.png
[ "https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-204x68.jpg 204w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-300x100.jpg 300w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-1024x341.jpg 1024w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-768x256.jpg 768w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1.jpg 1250w", "https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-204x68.jpg", "https://widgets.guidestar.org/TransparencySeal/7431867", "https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2024/03/NORD_MembershipLogo_PLAT_2024_RGB-01-150x150.webp", "https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2024/03/NORD_MembershipLogo_PLAT_2024_RGB-01-150x150.webp" ]
[]
[]
[ "" ]
null
[]
2020-04-10T20:16:09+00:00
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease.
en
https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2019/12/favicon.ico?time=1723756663
United Leukodystrophy Foundation
https://ulf.org/leukodystrophies/hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
causes of Neuroaxonal leukoencephalopathy with axonal spheriods Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease. The disease was described for the first time in multiple members of a large Swedish pedigree in 1984 (Axelsson et al, 1984). In this family, 17 of 71 subjects from 4 generations were affected. The age at onset varied from 8 to 60 years with a mean of 36 years. The age at death was 39 to 89 years with a mean of 57 years. The time between onset and death varied from 3 months to over 30 years. Some patients rapidly developed severe dementia and died a few months after the onset of symptoms, whereas in others the course was prolonged with dementia developing over decades. Sporadic patients have also been reported. The predominant clinical manifestations are psychiatric and include depression, anxiety, alcohol abuse, irritability, and aggressiveness. Psychotic symptoms may occur with confusion, delusions, and hallucinations. The most frequent neurologic symptoms are dementia, seizures, impaired balance, retropulsion, gait apraxia, spasticity, ataxia, and urinary incontinence. Extrapyramidal symptoms may occur with hyperkinesia, chorea, tremor and oral dyskinesia. EEG usually shows nonspecific abnormalities with slowing of the background pattern and sometimes paroxysmal changes. The abnormalities often have a frontotemporal predominance. They may be asymmetrical. Routine and metabolic laboratory investigations reveal no abnormalities. The diagnosis is at present based on histopathologic findings. Pathology External examination of the brain shows mild atrophy of the frontoparietal regions. The thalamus and the rostral part of the caudate nucleus may be mildly reduced in size. The lateral ventricles are moderately enlarged. The corticospinal tracts and the basis of the pons are atrophic. On microscopy, a widespread leukoencephalopathy is found, characterized by a commensurate loss of myelin sheaths and axons and the presence of numerous neuroaxonal spheroids in the affected white matter. Neuroaxonal spheroids are round to sausage-shaped axonal swellings, which are easily identified with Bielschowsky, Bodian, and anti-neurofilament immunostains. The leukoencephalopathy is most severe in the frontal, frontoparietal and temporal areas and may be mildly asymmetrical. The U-fibers are relatively spared. The abnormalities tend to be most pronounced in the white matter below the pre- and postcentral gyri and extend through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The corpus callosum is variably affected. The abnormal white matter may show vacuolization. Reactive astrocytes and macrophages are present, but no inflammatory cells. The cerebral cortex and basal ganglia are normal and contain no or only few spheroids. Within the cerebellum, a marked loss of Purkinje cells is seen, but the cerebellar white matter is normal. Electron microscopy of the spheroids reveals neurofilaments scattered among electron-dense material and mitochondria. Pathogenetic Considerations The homogeneity of the clinical picture and histopathologic findings strongly suggests that HDLS is a distinct disease entity. The disease has an autosomal dominant mode of inheritance. Isolated cases are probably the result of new mutations. The genetic defect and the pathophysiology of HDSL are as yet unresolved. Considering the more or less commensurate loss of axons and myelin sheaths, the preferential involvement of long tracts and the presence of axonal swellings, it is likely that axons are the primary target of the disease. Axonal spheroids are pathologic findings characteristic of the neuroaxonal dystrophies. They occur most often in the context of neuronal degenerative disorders, such as infantile neuroaxonal dystrophy (Seitelberger disease) and Hallervorden-Spatz disease. The combination of a leukoencephalopathy and neuroaxonal spheroids in the abnormal white matter is rare. Apart form HDSL, this combination is observed in dermatoleukodystrophy with neuroaxonal spheroids (Matsuyama et al, 1978) and polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (Nasu-Hakola disease). Both disorders are clinically different form HDLS. How is Neuroaxonal Leukoencephalopathy with axonal spheriods treated? Supportive care is the only therapeutic option. Magnetic Resonance Imaging MR images demonstrate signal abnormalities bilaterally within the cerebral white matter, either most pronounced within the white matter under the pre- and postcentral gyri, or within the frontal white matter. The signal abnormalities may be patchy or more confluent, and may be symmetrical or asymmetrical. They are ill-defined. The corpus callosum is thin and may contain areas of abnormal signal. The signal abnormalities extend downwards through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The affected cerebral white matter is atrophic with widening of the lateral ventricles and subarachnoid spaces. The head of the caudate nucleus may be flattened. There may be cerebellar atrophy. The above MRI findings may confirm the diagnosis within a pedigree with known HDLS. However, the MRI findings in itself are not specific and do not allow definite diagnosis. The diagnosis needs to be confirmed by histopathology. The differential diagnosis of HDLS includes disorders with frontal cortical degeneration, such as frontotemporal dementia and Pick disease. In these disorders MRI shows atrophy of mainly the frontotemporal areas. Sometimes there are additional white matter changes, which are ill-defined and usually mild. If present, they make differentiation from HDLS difficult. The differential diagnosis also includes disorders with frontal lobe dysfunction caused by white matter degeneration, such as metachromatic leukodystrophy, X-linked adrenoleukodystrophy with frontal predominance, Nasu-Hakola disease (PLOSL), Binswanger disease, CADASIL, orthochromatic pigmentary leukodystrophy, and adult-oset autosomal dominant leukodystrophies. Most disorders can be ruled out by typical clinical, physical and laboratory findings and neuroimaging differences. Some disorders require histopathologic confirmation. Courtesy of Van der Knaap et al, Neurology 2000; 54: 463-468, with permission
1850
dbpedia
1
49
https://www.hopkinsmedicine.org/health/conditions-and-diseases/high-cholesterol/what-to-do-when-high-cholesterol-runs-in-your-family
en
What to Do When High Cholesterol Runs in Your Family
https://www.hopkinsmedic…sterol640440.jpg
https://www.hopkinsmedic…sterol640440.jpg
[ "https://www.hopkinsmedicine.org/-/media/images/hopkins-medicine-logo-white-header.svg?iar=0&hash=C6173D209DB591FDF4EFE00B18C2FFE4", "https://www.hopkinsmedicine.org/-/media/images/health/5-_-physicians-photos/l-_-s/seth-martin.jpg?h=100&iar=0&w=80&hash=2FC32A5DDA767920F8F86E052340DCEC", "https://www.hopkinsmedicine.org/-/media/images/health/1_-conditions/high-cholesterol/hereditarycholesterol640440.jpg?h=358&iar=0&mh=360&mw=520&w=520&hash=F1692F2DF701F72B29C85F6A06E9ED0A", "https://www.hopkinsmedicine.org/-/media/images/health/3_-wellness/heart-health/heart-puzzle-teaser.jpg?h=320&iar=0&w=560&hash=7D52816BDA5F8628850BEE0083353470", "https://www.hopkinsmedicine.org/-/media/project/jhm/icons/jhmcalendar.svg?iar=0&hash=9758E8BED5D3E0BEC4202D7B92AC5624", "https://www.hopkinsmedicine.org/-/media/images/health/3_-wellness/heart-health/heart-puzzle-teaser.jpg?h=217&iar=0&mh=260&mw=380&w=380&hash=5E21A302BDF6024FA35C5BBCC48A5C8C", "https://www.hopkinsmedicine.org/-/media/images/health/3_-wellness/heart-health/workout-gear-teaser.jpg?h=217&iar=0&mh=260&mw=380&w=380&hash=879F5F44454AFD37AC786A3B4A03DF33", "https://www.hopkinsmedicine.org/-/media/images/health/3_-wellness/heart-health/cholesterol640_2_pyramid.jpg?h=260&iar=0&mh=260&mw=380&w=379&hash=A6DD68ED87149D07DB2F032540CF5C87", "https://www.hopkinsmedicine.org/-/media/images/hopkins-nav-logo.svg" ]
[]
[]
[ "" ]
null
[]
2021-11-11T00:00:00
Because high cholesterol doesn’t have any symptoms, it’s not something that’s commonly on people’s radar.
en
/favicon.ico
https://www.hopkinsmedicine.org/health/conditions-and-diseases/high-cholesterol/what-to-do-when-high-cholesterol-runs-in-your-family
Featured Expert:
1850
dbpedia
0
52
https://researchportal.lih.lu/en/publications/de-novo-mutations-in-hereditary-diffuse-leukoencephalopathy-with-
en
De novo mutations in hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS)
https://researchportal.lih.lu/skin/headerImage/
https://researchportal.lih.lu/skin/headerImage/
[ "https://researchportal.lih.lu/skin/headerImage/" ]
[]
[]
[ "" ]
null
[ "Kathrin N. Karle", "Saskia Biskup", "Rebecca Schüle", "Katherine J. Schweitzer", "Rejko Krüger", "Peter Bauer", "Benjamin Bender", "Thomas Nägele", "Ludger Schöls" ]
null
en
Luxembourg Institute of Health
https://researchportal.lih.lu/en/publications/de-novo-mutations-in-hereditary-diffuse-leukoencephalopathy-with-
Objective: Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) is caused by autosomal-dominantly inherited mutations in the colony stimulating factor 1 receptor (CSF1R) gene, and is clinically characterized by a progressive cognitive and motor decline leading to death within several years. Methods: In a continuous series of 25 patients with adult-onset leukoencephalopathy of unknown cause, we genetically confirmed HDLS in 6 families. Affected and nonaffected individuals were examined clinically and by brain MRI studies. Results: HDLS presented as prominent dementia and apraxia, often with extrapyramidal and pyramidal signs, rarely with ataxia. White matter MRI changes were detectable early in the disease course. Family history was negative in 4 of 6 index patients. In 2 of 6 index patients, we could confirm the occurrence of de novo mutations in the CSF1R gene. One family showed possible incomplete penetrance: the 69-year-old father of the index patient carried a CSF1R mutation but was clinically unaffected. In one family, the parents were apparently unaffected and not available for genetic testing. Conclusions: Typical clinical phenotype and early brain MRI alterations can help to guide the diagnosis of HDLS. Because we confirmed de novo mutations in one-third of patients with CSF1R mutations, this diagnosis should be considered even in the absence of a family history. Furthermore, we present evidence for reduced penetrance of a CSF1R mutation. These results have substantial impact for genetic counseling of asymptomatic individuals at risk and should foster research into disease-modifying factors. TY - JOUR T1 - De novo mutations in hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) AU - Karle, Kathrin N. AU - Biskup, Saskia AU - Schüle, Rebecca AU - Schweitzer, Katherine J. AU - Krüger, Rejko AU - Bauer, Peter AU - Bender, Benjamin AU - Nägele, Thomas AU - Schöls, Ludger PY - 2013/12/3 Y1 - 2013/12/3 N2 - Objective: Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) is caused by autosomal-dominantly inherited mutations in the colony stimulating factor 1 receptor (CSF1R) gene, and is clinically characterized by a progressive cognitive and motor decline leading to death within several years. Methods: In a continuous series of 25 patients with adult-onset leukoencephalopathy of unknown cause, we genetically confirmed HDLS in 6 families. Affected and nonaffected individuals were examined clinically and by brain MRI studies. Results: HDLS presented as prominent dementia and apraxia, often with extrapyramidal and pyramidal signs, rarely with ataxia. White matter MRI changes were detectable early in the disease course. Family history was negative in 4 of 6 index patients. In 2 of 6 index patients, we could confirm the occurrence of de novo mutations in the CSF1R gene. One family showed possible incomplete penetrance: the 69-year-old father of the index patient carried a CSF1R mutation but was clinically unaffected. In one family, the parents were apparently unaffected and not available for genetic testing. Conclusions: Typical clinical phenotype and early brain MRI alterations can help to guide the diagnosis of HDLS. Because we confirmed de novo mutations in one-third of patients with CSF1R mutations, this diagnosis should be considered even in the absence of a family history. Furthermore, we present evidence for reduced penetrance of a CSF1R mutation. These results have substantial impact for genetic counseling of asymptomatic individuals at risk and should foster research into disease-modifying factors. AB - Objective: Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) is caused by autosomal-dominantly inherited mutations in the colony stimulating factor 1 receptor (CSF1R) gene, and is clinically characterized by a progressive cognitive and motor decline leading to death within several years. Methods: In a continuous series of 25 patients with adult-onset leukoencephalopathy of unknown cause, we genetically confirmed HDLS in 6 families. Affected and nonaffected individuals were examined clinically and by brain MRI studies. Results: HDLS presented as prominent dementia and apraxia, often with extrapyramidal and pyramidal signs, rarely with ataxia. White matter MRI changes were detectable early in the disease course. Family history was negative in 4 of 6 index patients. In 2 of 6 index patients, we could confirm the occurrence of de novo mutations in the CSF1R gene. One family showed possible incomplete penetrance: the 69-year-old father of the index patient carried a CSF1R mutation but was clinically unaffected. In one family, the parents were apparently unaffected and not available for genetic testing. Conclusions: Typical clinical phenotype and early brain MRI alterations can help to guide the diagnosis of HDLS. Because we confirmed de novo mutations in one-third of patients with CSF1R mutations, this diagnosis should be considered even in the absence of a family history. Furthermore, we present evidence for reduced penetrance of a CSF1R mutation. These results have substantial impact for genetic counseling of asymptomatic individuals at risk and should foster research into disease-modifying factors. UR - http://www.scopus.com/inward/record.url?scp=84892428109&partnerID=8YFLogxK U2 - 10.1212/01.wnl.0000436945.01023.ac DO - 10.1212/01.wnl.0000436945.01023.ac M3 - Article C2 - 24198292 AN - SCOPUS:84892428109 SN - 0028-3878 VL - 81 SP - 2039 EP - 2044 JO - Neurology JF - Neurology IS - 23 ER -
1850
dbpedia
3
11
https://medlineplus.gov/genetics/condition/familial-hdl-deficiency/
en
Familial HDL deficiency: MedlinePlus Genetics
https://medlineplus.gov/…dition_Share.jpg
https://medlineplus.gov/…dition_Share.jpg
[ "https://medlineplus.gov/uswds/img/us_flag_small.png", "https://medlineplus.gov/uswds/img/icon-dot-gov.svg", "https://medlineplus.gov/uswds/img/icon-https.svg", "https://medlineplus.gov/images/nihlogo.png", "https://medlineplus.gov/images/m_logo_25.png", "https://medlineplus.gov/css/img/icon_camera_small.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/nih.png", "https://medlineplus.gov/images/PX00012W_PRESENTATION.jpeg", "https://medlineplus.gov/images/feed.png", "https://medlineplus.gov/images/i_share_twitter.png", "https://medlineplus.gov/images/i_share_fb.png", "https://medlineplus.gov/images/Instagram_Glyph_Gradient_RGB.png", "https://medlineplus.gov/images/i_social_media_toolkit.png", "https://medlineplus.gov/images/return-top.png" ]
[]
[]
[ "" ]
null
[]
null
Familial HDL deficiency is a condition characterized by low levels of high-density lipoprotei% (HDL) in the blood. Explore symptoms, inheritance, genetics of this condition.
en
https://medlineplus.gov/images/favicon.ico
https://medlineplus.gov/genetics/condition/familial-hdl-deficiency/
Familial HDL deficiency is a condition characterized by low levels of high-density lipoprotei% (HDL) in the blood. HDL is a molecule that transports cholesterol and certain fats called phospholipids through the bloodstream from the body's tissues to the liver. Once in the liver, cholesterol and phospholipids are redistributed to other tissues or removed from the body. HDL is often referred to as "good cholesterol" because high levels of this substance reduce the chances of developing heart and blood vessel (cardiovascular) disease. People with familial HDL deficiency may develop cardiovascular disease at a relatively young age, often before age 50. Severely reduced levels of HDL in the blood is a characteristic feature of a related disorder called Tangier disease. People with Tangier disease have additional signs and symptoms, such as disturbances in nerve function; enlarged, orange-colored tonsils; and clouding of the clear covering of the eye (corneal clouding). However, people with familial HDL deficiency do not have these additional features. Mutations in the ABCA1 gene or the APOA1 gene cause familial HDL deficiency. The proteins produced from these genes work together to remove cholesterol and phospholipids from cells. The ABCA1 gene provides instructions for making a protein that removes cholesterol and phospholipids from cells by moving them across the cell membrane. The movement of these substances across the membrane is enhanced by another protein called apolipoprotein A-I (apoA-I), which is produced by the APOA1 gene. Once outside the cell, the cholesterol and phospholipids combine with apoA-I to form HDL. ApoA-I also triggers a reaction that converts cholesterol to a form that can be fully integrated into HDL and transported through the bloodstream. ABCA1 gene mutations and some APOA1 gene mutations prevent the release of cholesterol and phospholipids from cells. Other mutations in the APOA1 gene reduce the protein's ability to stimulate the conversion of cholesterol. These ABCA1 and APOA1 gene mutations decrease the amount of cholesterol or phospholipids available to form HDL, resulting in low levels of HDL in the blood. A shortage (deficiency) of HDL is believed to increase the risk of cardiovascular disease.
1850
dbpedia
2
0
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/
en
Clinical features and genetic characteristics of hereditary diffuse leukoencephalopathy with spheroids due to CSF1R mutation: a case report and literature review
https://www.ncbi.nlm.nih…rd-share.jpg?_=0
https://www.ncbi.nlm.nih…rd-share.jpg?_=0
[ "https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png", "https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg", "https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg", "https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg", "https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/logo-anntransmed.png", "https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/corrauth.gif", "https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/corrauth.gif", "https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/corrauth.gif", "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/bin/atm-08-01-11-f1.jpg", "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/bin/atm-08-01-11-f2.jpg" ]
[]
[]
[ "" ]
null
[ "Lv-Ping Zhuang", "Chang-Yun Liu", "Yuan-Xiao Li", "Hua-Ping Huang", "Zhang-Yu Zou" ]
2020-01-19T00:00:00
Hereditary diffuse leukoencephalopathy with spheroid (HDLS) is an autosomal dominant white matter disease characterized by adult-onset cognitive impairment, behavioral or emotional changes, paresis, Parkinsonism, and seizures. Mutations in the gene encoding ...
en
https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/favicons/favicon.ico
PubMed Central (PMC)
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/
Discussion In this study, we identified a novel missense mutation p.G651E in the CSF1R gene in a patient presenting with adult-onset leukoencephalopathy, cognitive impairment and motor dysfunction. G651 is highly conserved across species ( ) and lies in the TKD domain, the critical domain of CSF1R (PM1). The p.G651H variant was absent from the control databases (gnomAD, 1000 Genomes Project, ClinVar) (PM2). In silico tools indicated the variant was deleterious (PP3), and the patient’s phenotype and family history are highly specific for a disease with a single genetic etiology (PP4). Therefore, according to the guidelines of the American College of Medical Genetics and Genomics for sequence variant interpretation, the p.G651E variant was interpreted as likely pathogenic (6). The patient had the core features of HDLS: age at onset ≤60 years, cognitive impairment and pyramidal signs, autosomal dominant inheritance, bilateral cerebral white matter lesions and thinning of the corpus callosum in brain MRI images. He also carried a CSF1R gene mutation. Therefore, a diagnosis of definite HDLS can be made according to the diagnostic criteria (7). Our review showed that average age of onset of patients with HDLS is 43 years; however, the onset age can vary from 10 to 71 years. This disease is clinically characterized by two groups of symptoms: neuropsychiatric and motor symptoms (8). The neuropsychiatric symptoms include memory impairment, progressive cognitive decline, depression, apathy, anxiety, and other behavioral or personality changes. Motor symptoms include Parkinsonism, pyramidal signs, dysarthria, dysphagia, and ataxia (8). The most common clinical characteristic of patients with HDLS is cognitive impairment (84%), followed by psychiatric symptoms, Parkinsonism, gait disorders, and dysphagia. The neuroradiographic characteristics of patients with HDLS are bilateral but asymmetric T2-weighted and FLAIR hyperintensities in the deep and subcortical white matter, predominantly in the frontal, frontoparietal, and periventricular areas ( ) (5,8). Early lesions are patchy and focal, but with time spread around and become confluent. The preferential involvement of the frontal white matter may account for the predominant cognitive impairment and psychiatric symptoms in patients with HDLS. Diffusion-restricted lesions with reduced ADC can be observed in the white matter and can be persistent for several months or more, which can be differentiated from stroke. There was no enhancement and microbleeding. Thinning of the corpus callosum, cerebral atrophy and dilation of the lateral ventricles is typical, even in the early phases of the disease. Calcifications in the white matter on CT scan are characteristic imaging features of HDLS and demonstrate a “stepping stone appearance” in the frontal pericallosal area and punctate appearance in the frontal white matter adjacent to the anterior horns of the lateral ventricles (8). It should be noted that neuroradiographical abnormalities could precede the presence of clinical symptoms. At least three asymptomatic CSF1R mutation carriers with subtle T2 hyperintensities or bilateral white matter lesion, abnormal signals in lateral ventricle and frontal lobe have been reported (9,10). So far, there have been no obvious genotype-phenotype correlations regarding HDLS, with some family members showing significant differences in disease presentation and course within the same family. Therefore, the clinical symptoms of patients with HDLS are variable and easily misdiagnosed with other diseases. Patients with HDLS presented with cognitive decline and personality changes in midlife with a progressive course, and evident white matter lesions on MRI should be differentiated with other leukoencephalopathy, such as adult-onset autosomal dominant leukodystrophy, Alexander disease, or cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Patients with predominant motor symptoms are easily misdiagnosed as multiple sclerosis, especially during the earliest phases of the disease (1). Recently, Konno et al proposed a diagnostic criterion for CSF1R-related leukoencephalopathy. The criteria yield high sensitivity (96%) and can successfully exclude other leukoencephalopathy. If a patient fulfills the probable criteria, genetic testing for CSF1R should be performed (7). The mean disease duration for patients with HDLS was 6.2 years ( ). However, the rate of progression varies among individuals and patients may develop a rapid progression or a very slow progression (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). Indicators of rapid disease progression of patients with HDLS were symptomatic disease onset before 45 years, female, white matter lesions extending beyond the frontal regions, an MRI severity score based on a point system [0–57] greater than 15 points, and mutation type of deletion (11). Although HDLS is usually inherited in an autosomal dominant pattern, 36% of HDLS cases were apparent sporadic cases (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). However, whether these sporadic cases reflect incomplete or non-penetrance or were caused by de novo mutations in the CSF1R gene remains unknown. The HDLS pedigrees reported so far showed that mutations in CSF1R have a high penetrance, but in one family carrying the CSF1R p.Q877X mutation and another p.V784M mutated pedigree, the index patient was severely affected since the age of 28 years whereas their parents who carried the same CSF1R mutation still had no neurological symptoms at 69 years and 79 years, suggesting incomplete penetrance in HDLS (9,12). In addition, three confirmed de novo CSF1R mutations (3,9) and two apparent (without paternity confirmation) de novo CSF1R mutations (13,14) have been reported in patients with HDLS, suggesting at least some patients with HDLS are true sporadic and caused by de novo mutations in the CSF1R gene. CSF1R is an essential factor for development and maintenance of microglia. Approximately 95% of CSF1R mutations in HDLS are located within the TKD ( ), suggesting that loss of tyrosine kinase activity may be necessary for the development of HDLS. Reduced expression of CSF1R was also observed in brains of patients with missense and splice-site mutations, indicating that any type of CSF1R mutation may cause HDLS by haploinsufficiency (4,15) ( ). A mutant CSF1R mouse strain with a haploinsufficient allele developed HDLS-like symptoms, including cognitive decline, behavioral changes, and motor symptoms. White matter abnormalities, enlargement of the lateral ventricles, and thinning of the corpus callosum were also evident on MRI. The mouse model provides strong evidence that CSF1R haploinsufficiency is enough to cause white matter degeneration (16). However, marginally elevated cell surface CSF1 receptor levels with increased Tyr723 autophosphorylation was observed in a HDLS patient with CSF1R p.I843_L844delinsGI mutation, suggesting a mutation-related CSF1R gain-of-function (17). Notably, mutations tend to occur more frequently in the distal part of the TKD than the proximal part (5), and exons 18­–­20 of CSF1R gene are mutation hotspots where 63% of CSF1R mutations exist ( ). Further functional experiments are needed to elucidate the pathogenesis of CSF1R mutations. In conclusion, HDLS typically presents with broad phenotypic variability, and although it demonstrates an autosomal dominant pattern, sporadic cases are not uncommon. Early recognition of clinical and neuroradiographical characteristics of HDLS is key for the correct diagnosis of the disease, given the poor prognosis, rapid course, and genetic testing implications for family members.
1850
dbpedia
3
46
https://www.betterhealth.vic.gov.au/health/conditionsandtreatments/genetic-factors-and-cholesterol
en
Genetic factors and cholesterol
https://www.betterhealth…mg/bhc-ogimg.png
https://www.betterhealth…mg/bhc-ogimg.png
[ "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/logo.png", "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/dhlogo.png", "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/logo.png", "https://content.dhhs.vic.gov.au/sites/default/files/site_logo/dhlogo.png", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png", "https://content.dhhs.vic.gov.au/sites/default/files/logo-VCGS.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png", "https://content.dhhs.vic.gov.au/sites/default/files/logo-VCGS.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png", "https://content.dhhs.vic.gov.au/sites/default/files/logo-VCGS.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/flag-torres-strait.8fc9c3c.png", "https://www.betterhealth.vic.gov.au/_nuxt/img/pride-progress-flag.c1c6916.png", "https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DHHS.8d8f412.jpg", "https://www.betterhealth.vic.gov.au/_nuxt/img/footer-logo.c95ca18.png" ]
[]
[]
[ "angina", "chest pain", "cholesterol", "cholesterol-lowering drugs", "genetic condition", "genetic counselling", "heart attacks young", "high blood cholesterol", "high LDL", "inherited conditions", "plant sterols", "plant stanols" ]
null
[]
2003-01-28T00:00:00
Familial hypercholesterolaemia is an inherited condition characterised by higher than normal levels of blood cholesterol.
en
/favicon.ico
http://www.betterhealth.vic.gov.au/health/conditionsandtreatments/genetic-factors-and-cholesterol
Cholesterol is an essential component of cell membranes and is needed for many bodily functions, such as the production of hormones. It is produced when foods containing oil and fat are digested. It is also produced in the liver. Cholesterol in the blood is found in two types of particles. The cholesterol in low density lipoproteins (LDL) is known as the ‘bad’ cholesterol because it contributes to heart disease by ‘sticking’ to and narrowing the arteries supplying the heart. High density lipoprotein (HDL) cholesterol is known as the ‘good’ cholesterol because it keeps LDL levels in check. Familial hypercholesterolaemia is an inherited condition characterised by higher than normal levels of LDL blood cholesterol. Familial hypercholesterolaemia causes up to 10 per cent of early onset coronary artery disease – heart disease that occurs before the age of 55 years. The cause is a mutation in a gene. About one in every 300 Australians is thought to be affected. Other names for familial hypercholesterolaemia include familial hyperlipidaemia, hypercholesterolaemic xanthomatosis and low density lipoprotein receptor mutation. Symptoms of familial hypercholesterolaemia High blood cholesterol can be asymptomatic, which means the person may not even realise they have it. Some of the signs and symptoms of familial hypercholesterolaemia can include: family history of the disorder family history of heart attacks at an early age high LDL cholesterol levels that resist treatment in one or both parents cholesterol deposits on the knees, elbows and buttocks (xanthomas) high blood cholesterol levels chest pain caused by narrowed coronary arteries (angina) heart attack early in life. Genetics of familial hypercholesterolaemia Cholesterol is delivered to cells via the bloodstream. Normally, the tiny particles of LDL cholesterol attach to ‘receptor’ sites on the targeted cells and are then absorbed. A gene on chromosome 19, called the LDLR gene, controls the production of these receptors. Most familial hypercholesterolaemia is due to a mutation of the LDLR gene that changes the way the receptors develop, either in number or structure. This means that LDL cholesterol is not well absorbed into cells, and remains circulating in the blood. High blood cholesterol is a risk factor in coronary artery disease, because it sticks to the artery walls, produces fatty plaques and narrows the diameter of the arteries (atherosclerosis). Less commonly, familial hypercholesterolemia is caused by a mutation on other genes, such as APOB or PCSK9. Pattern of inheritance for familial hypercholesterolaemia Familial hypercholesterolaemia is an autosomal dominant disorder. In the great majority of cases, the gene is inherited from just one parent. Very rarely, it is inherited from both. One parent If one parent has one mutated gene and one normal gene in the pair, each child of this parent has a 50 per cent chance of inheriting the mutated gene. The risk of developing early coronary artery disease depends on the gender of the child and includes: Around 50 per cent of males who inherit the genetic mutation from this parent will develop coronary artery disease before the age of 50 years. All of the affected male children of this parent will develop heart disease by the age of 70 years. About 85 per cent of affected male children of this parent will have a heart attack before the age of 60 years. Around 12 per cent of females who inherit the genetic mutation from this parent will develop coronary artery disease before the age of 50 years, and 74 per cent by the age of 70 years. Two parents If both parents carry the mutated gene, each child has a 25 per cent chance of inheriting both the genes containing mutations. In this case, the child will develop a severe form of coronary artery disease very early in life, perhaps while still in childhood. This form of familial hypercholesterolaemia is resistant to treatment. Despite medical intervention, the risk of heart attack remains high. Symptoms can include patches of excess cholesterol collecting in the skin, particularly at the elbows, knees and buttocks. Diagnosis of familial hypercholesterolaemia Familial hypercholesterolaemia is diagnosed using a number of tests including: physical examination blood tests heart tests, such as the stress test genetic tests. Treatment for familial hypercholesterolaemia There is no cure for familial hypercholesterolaemia. Treatment aims to reduce the person’s risk of coronary artery disease and heart attack, and may include: Dietary changes – recommended dietary changes include reduced intake of saturated fats and cholesterol-rich foods, and increased intake of fibre. Modifying the diet is usually the first line of treatment. After three months, test results will show whether more aggressive treatment is needed. Plant sterols and stanols – these substances are structurally similar to cholesterol, but aren’t absorbed by the cells. Studies show that increasing the intake of plant sterols and stanols can substantially reduce blood cholesterol. Sources include corn, rice, vegetable oils and nuts. Exercise – regular exercise has been shown to reduce blood cholesterol levels. Any exercise program should be supervised by your doctor. Weight loss – obesity is a risk factor. Maintaining a healthy weight for your height can reduce your risk of coronary artery disease and heart attack. Avoid smoking – cigarette smoke encourages cholesterol to ‘stick’ to artery walls. Quitting can significantly reduce your risk of heart attack. Medication – very few people with familial hypercholesterolaemia will be able to reduce their cholesterol levels by diet and lifestyle changes alone. Most will need special cholesterol-lowering drugs. Where to get help
1850
dbpedia
3
66
https://health.gov/myhealthfinder/doctor-visits/screening-tests/get-your-cholesterol-checked
en
Get Your Cholesterol Checked - MyHealthfinder
https://health.gov/theme…ages/favicon.png
https://health.gov/theme…ages/favicon.png
[ "https://health.gov/sites/default/files/styles/600_wide/public/2022-06/gycc.jpg?itok=tfjiQVwQ", "https://health.gov/sites/default/files/styles/topic_card_image/public/2022-07/ryros.jpg?itok=q02-KyqE", "https://health.gov/sites/default/files/styles/topic_card_image/public/2022-07/kyhh.jpg?itok=eEQm-gFE", "https://health.gov/sites/default/files/styles/topic_card_image/public/2023-03/Heart-healthy-foods-shopping_1035544898.jpg?itok=jRfFCfLv", "https://health.gov/themes/custom/healthfinder/images/oash-logo-white-bg.svg" ]
[]
[]
[ "" ]
null
[]
2022-05-01T12:00:00+00:00
Too much cholesterol in your blood can cause a heart attack or a stroke. Share this resource to encourage people age 40 to 75 to get their cholesterol checked regularly.
en
/themes/custom/healthfinder/images/favicon.png
https://health.gov/myhealthfinder/doctor-visits/screening-tests/get-your-cholesterol-checked
It's important to get your cholesterol checked regularly. Too much cholesterol in your blood can cause a heart attack or a stroke. The good news is that it’s easy to get your cholesterol checked. If your cholesterol is high, you can take steps to lower it — like eating healthy, getting more physical activity, and taking medicine if your doctor recommends it. How often do I need to get my cholesterol checked? The general recommendation is to get your cholesterol checked every 4 to 6 years. Some people may need to get their cholesterol checked more often depending on their risk of heart disease. For example, high cholesterol can run in families. If someone in your family has high cholesterol or takes medicine to control cholesterol, you might need to get tested more often. Talk to your doctor about what’s best for you. What is cholesterol? Cholesterol is a waxy material that’s found naturally in your blood. Your body makes cholesterol and uses it to do important things, like making hormones and digesting fatty foods. If you have too much cholesterol in your body, it can build up inside your blood vessels and make it hard for blood to flow through them. Over time, this can lead to heart disease. What do the test results mean? If you get a lipid profile test, the results will show a few numbers. A lipid profile measures: Total cholesterol LDL (bad) cholesterol HDL (good) cholesterol Triglycerides Total cholesterol is a measure of all the cholesterol in your blood. It's based on the LDL, HDL, and triglycerides numbers. LDL cholesterol is a “bad” type of cholesterol that can block your arteries — so a lower level is better for you. Having a high LDL level can increase your risk for heart disease. HDL cholesterol is the “good” type of cholesterol that helps clear LDL cholesterol out of your arteries — so a higher level is better for you. Having a low HDL cholesterol level can increase your risk for heart disease. Triglycerides are a type of fat in your blood that can increase your risk for heart attack and stroke. The results of your lipid profile test may also show your non-HDL cholesterol number. Non-HDL cholesterol is LDL cholesterol and the other “bad” types of cholesterol. In other words, it’s your total cholesterol minus your HDL cholesterol. Having a high non-HDL level can increase your risk for heart disease. Find out what your cholesterol levels are. If your cholesterol is high or you're at risk for heart disease, take steps to control your cholesterol levels. Make an appointment to get your cholesterol checked. Call your doctor’s office or health center to schedule the test. Be sure to ask for a complete lipid profile — and find out what instructions you’ll need to follow before the test. For example, you may need to fast (not eat or drink anything except water) for 9 to 12 hours before the test. You may also want to print these questions to ask your doctor about cholesterol and take them to your appointment. What about cost? Under the Affordable Care Act, insurance plans must cover cholesterol testing. Depending on your insurance plan, you may be able to get your cholesterol checked at no cost to you. Check with your insurance company to find out more. Medicare may also cover cholesterol testing at no cost. If you have Medicare, learn about Medicare coverage for cholesterol testing. If you don't have insurance, you may still be able to get free or low-cost cholesterol testing. Find a health center near you and ask about cholesterol testing. To learn more, check out these resources about: Free preventive care for adults covered by the Affordable Care Act How the Affordable Care Act protects you Understanding your health insurance and how to use it [PDF - 698 KB] Keep track of your cholesterol levels. Remember to ask the doctor or nurse for your cholesterol levels each time you get your cholesterol checked. Write the levels down to keep track of your progress. Get active. Getting active can help you lose weight, lower your LDL (bad) cholesterol, and raise your HDL (good) cholesterol. Aim for at least 150 minutes of aerobic activity a week — try starting with a brisk walk Break up your 150 minutes however you want — try doing aerobic activity for 30 minutes 5 times a week Do muscle-strengthening activities 2 days a week — try lifting weights or doing push-ups Remember, any amount of physical activity is better than none. If you haven’t been active before, start with just 5 minutes and build up from there. To help you get more active: Check out our guide to physical activity Use this tool to build a personalized weekly activity plan Quit smoking. Quitting smoking can help lower your cholesterol. If you smoke, make a plan to quit today. Call 1-800-QUIT-NOW (1-800-784-8669) for free support and to set up your quit plan. Check out our tips for quitting smoking. Drink alcohol only in moderation. Drinking too much alcohol can increase your risk of high cholesterol. So if you choose to drink alcohol, drink only in moderation. That means 1 drink or less in a day for women and 2 drinks or less in a day for men. Learn more about drinking alcohol only in moderation.
1850
dbpedia
0
33
https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-019-0843-y
en
An AARS variant as the likely cause of Swedish type hereditary diffuse leukoencephalopathy with spheroids
https://static-content.s…43_Fig1_HTML.png
https://static-content.s…43_Fig1_HTML.png
[ "https://pubads.g.doubleclick.net/gampad/ad?iu=/270604982/bmc/actaneurocomms/articles&sz=728x90,970x90&pos=LB1&doi=10.1186/s40478-019-0843-y&type=article&kwrd=Swedish type hereditary diffuse Leukoencephalopathy with spheroids,HDLS,Alanyl tRNA synthetase,AARS&pmc=B18006,H4800X,H36001&", "https://actaneurocomms.biomedcentral.com/static/images/bmc/logos/logo-bmc-white-aj-be532aa3f0.svg", "https://actaneurocomms.biomedcentral.com/static/images/bmc/logos/logo-bmc-white-strapline-sn-f224388d67.svg", "https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-019-0843-y/MediaObjects/40478_2019_843_Fig1_HTML.png", "https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-019-0843-y/MediaObjects/40478_2019_843_Fig2_HTML.png", "https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-019-0843-y/MediaObjects/40478_2019_843_Fig3_HTML.png", "https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-019-0843-y/MediaObjects/40478_2019_843_Fig4_HTML.png", "https://pubads.g.doubleclick.net/gampad/ad?iu=/270604982/bmc/actaneurocomms/articles&sz=300x250&pos=MPU1&doi=10.1186/s40478-019-0843-y&type=article&kwrd=Swedish type hereditary diffuse Leukoencephalopathy with spheroids,HDLS,Alanyl tRNA synthetase,AARS&pmc=B18006,H4800X,H36001&", "https://actaneurocomms.biomedcentral.com/track/article/10.1186/s40478-019-0843-y", "https://actaneurocomms.biomedcentral.com/static/images/logo-springernature-acb40b85fb.svg" ]
[]
[]
[ "" ]
null
[ "Hedberg-Oldfors" ]
2019-11-27T00:00:00
Swedish type Hereditary Diffuse Leukoencephalopathy with Spheroids (HDLS-S) is a severe adult-onset leukoencephalopathy with the histopathological hallmark of neuraxonal degeneration with spheroids, described in a large family with a dominant inheritance pattern. The initial stage of the disease is dominated by frontal lobe symptoms that develop into a rapidly advancing encephalopathy with pyramidal, deep sensory, extrapyramidal and optic tract symptoms. Median survival is less than 10 years. Recently, pathogenic mutations in CSF1R were reported in a clinically and histologically similar leukoencephalopathy segregating in several families. Still, the cause of HDLS-S remained elusive since its initial description in 1984, with no CSF1R mutations identified in the family. Here we update the original findings associated with HDLS-S after a systematic and recent assessment of several family members. We also report the results from exome sequencing analyses indicating the p.Cys152Phe variant in the alanyl tRNA synthetase (AARS) gene as the probable cause of this disease. The variant affects an amino acid located in the aminoacylation domain of the protein and does not cause differences in splicing or expression in the brain. Brain pathology in one case after 10 years of disease duration showed the end stage of the disease to be characterized by widespread liquefaction of the white matter leaving only some macrophages and glial cells behind the centrifugally progressing front. These results point to AARS as a candidate gene for rapidly progressing adult-onset CSF1R-negative leukoencephalopathies.
en
/static/img/favicons/bmc/apple-touch-icon-582ef1d0f5.png
BioMed Central
https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-019-0843-y
All samples included in this study were collected from one large Swedish family originally described in 1984 [4]. The updated family tree is presented in Fig. 1 with four generations represented and including information from the most recent clinical assessments. DNA was extracted using QIAsymphony, following standard procedures. This study was approved by the Research Ethics Committee of Gothenburg (601–05, 1016–12). Genome-wide genotyping Samples from both patients (IV-33 and IV-36) and two unaffected relatives (IV-21 and IV-35) were genotyped using Illumina Infinium technology to identify the presence of any large structural variants (> 50 Kb) and large regions of homozygosity (> 1 Mb). The samples were genotyped using the HumanOmniExpress BeadChip according to manufacturer’s instructions, and data were visualized using the GenomeStudio Data Analysis Software (Illumina Inc.). Exome sequencing Genomic DNA samples from the two patients (IV-33 and IV-36) and two unaffected relatives (IV-21 and IV-35) were subjected to exome sequencing. Capture was performed using Illumina TruSeq Exome kit, and sequencing was done on Illumina’s HiSeq 2000 according to manufacturer’s instructions. After quality filters, reads were aligned to the hg19/GRCh37 reference genome using BWA v0.7.12 [18] and variants were called using GATK best practices v3.3–0 [8, 22]. In silico analyses Single nucleotide polymorphisms (SNPs) and insertions and deletions (Indels) were filtered to select rare exonic and splice-site variants predicted as deleterious (more details in the Additional file 1). In parallel we ranked the variants obtained from the exome sequencing and taking into account the diagnosis and family pedigree using Exomiser v7.2.1 [32] with the following parameters: autosomal dominant inheritance pattern, minor allele frequency (MAF) below 0.1%, and OMIM entry for Leukoencephalopathy, diffuse hereditary, with spheroids (# 221820). The predicted functional impact of the variants was evaluated using SIFT [30], PolyPhen-2 [2], MutationTaster2 [29] and CADD v1.3 [12] software. ClinVar (http://www.ncbi.nlm.nih.gov/clinvar/) was also used in the variants’ classification process. Sanger sequencing Candidate variants in AARS and ESRP2 were validated and screened in 21 additional family members of generation IV using Sanger sequencing. Regions containing the candidate variants were amplified by polymerase chain reaction (PCR) with Roche FastStart PCR Master Mix (Roche Diagnostics Corp) and sequenced with Applied Biosystems BigDye terminator v3.1 sequencing chemistry in an ABI3730XL genetic analyzer as per manufacturer’s instructions (Applied Biosystems). Primers are available upon request. The sequences were analyzed in Sequencher software v4.2 (Gene Codes) using ENSG00000090861 and ENSG00000103067 as reference sequences for AARS and ESRP2, respectively. Expression analysis For functional analysis of the missense variant identified in AARS, c.455G > T p.(Cys152Phe), total RNA was isolated from a post mortem occipital brain tissue sample stored in RNAlater, using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Valencia, CA). RNA was reverse transcribed with the QuantiTect reverse transcription kit (Qiagen), and AARS cDNA was analyzed by PCR with 20, 23 and 27 cycles followed by Sanger sequencing (primers are available upon request). Neuropathology analyses A postmortem examination was performed in case 1 at 57 years of age. The left part of the brain, most of the spinal cord and the left sciatic nerve were fixed in buffered paraformaldehyde. A part of the right half of the brain was frozen and stored at − 800 C and the rest was fixed in buffered glutaraldehyde together with a part of the cervical spinal cord and the right sciatic nerve. Microscopic examination included various parts of the cerebral cortex and underlying white matter, the basal ganglia, thalamus, brain stem, cerebellum, spinal cord and sciatic nerve. Staining of formalin-fixed paraffin embedded sections included hematoxylin-eosin, van Gieson staining, luxol fast blue-cresyl violet, periodic acid and Schiff reagent (PAS) and Berliner blue (iron). Autofluorescence was examined on unstained sections. Immunohistochemistry was performed for neurofilament protein (Dako M0762, 1:400), glial fibrillary acidic protein (GFAP; Dako Z0334, 1:10,000), CD68 (Dako IR613, 1:1) as a marker for macrophages and ubiquitin (Abcam ab134953). Updated information on the HDLS-S family The ancestor born in 1857 (I:1 in the pedigree) lived on a farm in an isolated area of Western Sweden. She suffered for 32 years from an undefined mental disorder with “epilepsy” and died from “brain hemorrhage”, but no medical records remain [4]. Of 8 HDLS cases in generations II-III, 5 were documented by relevant diagnostic codes or hospital records from regional psychiatric or geriatric institutions, with HDLS confirmed by histopathology in one (II:8). Three siblings in generation III were examined at our Gothenburg neurology or psychiatry university departments with a preliminary hospital diagnosis of presenile dementia. These 3 cases were the first in whom our clinical, genealogical, and neuropathological examinations defined HDLS (III:20, III:21 and III:22). Individual III:22 had consecutive neurological assessments throughout the course of disease. Two family members in generation III and one in generation IV committed suicide during middle age. Even though the documentation associated with these cases was sparse, we believe these suicidal cases could have been associated with incipient HDLS. One individual (III:19) was established to be a phenocopy [33]. During 2018, we updated the clinical evaluation of the 41 relatives in generation IV to verify the surprisingly low frequency of affected family members now generally above the risk age (present ages ranging from 46 to 85 years). Of these 41 family members 4 died: 2 from histologically verified HDLS (case 1 [IV:33] with neuropathology reported here, and case 2 [IV:36], with neuropathology reported before [33]); 1 allegedly from complications associated with diabetes (IV-5); and 1 from probable suicide in the context of drug abuse (IV-9). For 23 of the 37 family members currently alive, we identified no symptoms or signs of ongoing HDLS disease by personal contact during 2018 usually supported by formal neurological examination performed by the authors CS and OA. Additionally, no symptoms of HDLS were recorded for the remaining healthy family members taking part in this study as reported by close relatives during 2018. The authors followed 3 of these healthy relatives (IV-34, IV-35 and IV-37, children of HDLS affected individuals), by yearly neurological examinations and cerebral MRI during 5–7 years until 2018, all with negative results. In one individual (IV-38), previous publications and assessments suggested HDLS-S, however no disability developed over time. Even though he declined clinical examination, social function was reported to be excellent, indicating the absence of HDLS. One other family member declined to be contacted but was recently reported by relatives to be healthy. The present study is based on DNA specimens from the 2 affected and 23 unaffected family members in generation IV that were personally followed by the authors (CS and OA), as indicated in Fig. 1. Case 1 Individual IV-33 in Fig. 1, was previously reported [33, 36]. Briefly, at age 46 this previously healthy manual worker suffered a progressive personality change with striking passivity and loss of responsibility at work and at home. At his first examination half a year after onset we observed a debilitating frontal syndrome with total loss of insight, along with discrete pyramidal and deep sensory signs. During the subsequent 2 years he was in a permanent hyperactive state, incessantly walking, opening cupboards or clapping his hands, still with only moderate motor, sensory and extrapyramidal signs. In the fourth year of his disease he had developed complete hemianopia, and showed gradually increasing rigidity in all extremities, as well as primitive brain stem and grasp reflexes. For 6 years he remained in a vegetative state with a general decortical type of rigidity, a weak doll’s eye reaction and spontaneous respiration of Cheyne-Stokes type until he succumbed from respiratory infections at 57 years of age. Five consecutive MRI examinations up to 26 months disease duration with DTI showed a symmetric leukoencephalopathy with an unusual feature, a progressive rim of decreased diffusion expanding centrifugally through the white matter from the periventricular area of the frontal and occipital horns, leaving apparently disorganized tissue behind the rim [36]. Neuropathology assessment The brain weighed 1480 g. The leptomeninges were essentially normal and there was no apparent gyral atrophy. There were only minor atheromatous plaques in the extracerebral arteries on the brain surface. Transverse sections of the cerebrum showed extensive liquefaction of the white matter encompassing the centrum semiovale and surrounding the ventricles but sparing a subcortical rim including the arcuate fibers (Fig. 2a). The frontal parts of the temporal lobes were also spared. Corpus callosum and the internal capsule showed the same gelatinous liquified appearance, as well as the entire white matter surrounding the basal ganglia and the thalamus. The pons was flattened and there was a yellowish discoloration of the basal aspect of the lower brain stem corresponding to the pyramidal tracts. The cerebellum showed minor atrophy of the folia and the spinal cord appeared macroscopically normal. Microscopic examination of the cerebral cortex and underlying white matter showed essentially the same changes in various parts of the brain (Fig. 2). There was no major loss of cortical neurons but some appeared swollen. There were no neurofibrillary tangles or senile plaques as revealed by ubiquitin immunohistochemistry. There was mild gliosis that was variable in different parts of the brain (Fig. 2c) and microglial activation was also seen in the cortex (Fig. 2d). The subcortical white matter was to some extent spared (Fig. 2a-b) but showed accumulation of macrophages and marked gliosis (Fig. 2c). Occasional spheroids could be identified by hematoxylin and eosin staining and by immunohistochemistry for neurofilament protein, however, they were not abundant. The white matter in the border between the partly spared subcortical white matter and the liquified deep parts, showed increased number of cells and frequent corpora amylacea (Fig. 2e), fragmented axons partly with spheroid-like changes (Fig. 2f) and numerous large rounded pigmented macrophages (Fig. 2g-h) with PAS positive and autofluorescent granula (Fig. 2i-j) indicating storage of lipofuscin. Many macrophages included ubiquitinated inclusions. The deep white matter that had undergone severe degeneration with a gelatinous appearance showed sparse cell nuclei. The white matter of the internal capsule and the pyramidal tracts of the brain stem showed severe loss of myelin and gliosis. The pyramidal tracts showed vascular changes with thickening of the walls and narrow lumina (see below, spinal cord) but no general vasculopathy was observed in the brain. The basal ganglia and the thalamus appeared reduced in size and there was gliosis but no major reduction in neuronal cell density. Neither was there a major loss of neurons in the cranial nerve nuclei or the inferior olives. In the cerebellum there was a variable loss of Purkinje cells with a concomitant proliferation of Bergmann glia. There was gliosis in the cerebellar white matter and occasional spheroids, but the neurons of the dentate nucleus appeared to be spared. In the spinal cord there was an asymmetric degeneration of the pyramidal tracts affecting both the lateral and anterior cortico-spinal tracts with vascular changes (Fig. 2j-k). The dorsal columns were much less affected. The neurons of the anterior horns were preserved but frequently swollen. The anterior and posterior nerve roots were preserved as was the sciatic nerve. Case 2 Individual IV-36 in Fig. 1, was previously reported [33]. Briefly, at age 34 this woman, who worked with computer programming, had an insidious onset of cognitive problems followed by increasing sensibility disturbance of her right hand, leading to profound deep sensory ataxia difficult to distinguish from alien hand. In parallel she started to present dystonic and ballistic movements in her extremities, soon compromising her gait. Within months she was wheelchair bound with function loss from multiple cerebral regions, including a general pyramidal syndrome, and complete loss of her inferior visual fields. Two years after onset she was in an uncommunicative state, blind, with short attacks of severe rigidity. Her MRI showed symmetrical changes around the frontal and posterior horns, extending into the parietal centrum semiovale and across the corpus callosum, except for its midportion, also following the corticospinal tracts into the mesencephalon. HDLS was confirmed by characteristic autopsy findings as reported [33]. Genetic analyses Previous Sanger sequencing of CSF1R coding region in both patients did not identify rare variants predicted to be damaging and that could explain the disease in this family (data not shown). All variants identified in CSF1R by exome sequencing are presented in Additional file 1: Table S1. The analysis of genotyping array data from the CSF1R locus did not reveal any copy number variants (CNVs) that could be involved in the disease either. Similarly, the same analysis at a genome level did not identify CNVs shared by the two affected individuals and that could be considered pathogenic. Exome sequencing analysis revealed that both patients carried variants that were novel, heterozygous, and predicted to be deleterious in two genes associated with the nervous system: NM_001605.2:c.455G > T p.(Cys152Phe) in AARS and NM_024939.3:c.728 T > G p.(Val243Gly) in ESRP2. Both variants were absent in the two healthy relatives. After segregation analysis to validate the association of the variants with the disease, only p.Cys152Phe in AARS remained absent in all the healthy family members tested (Fig. 1 and Additional file 1: Figure S1). This variant is not described in the genome aggregation database (gnomAD), and it was not found in 1000 Swedish individuals [3]. The variant was predicted as damaging by different software: SIFT, PolyPhen-2 and MutationTaster2, and has a high CADD score of 34, suggesting a deleterious effect of the variant in the protein function. It occurs in an evolutionarily conserved amino acid located in the aminoacylation domain of the protein (Fig. 3). Expression analysis at transcript level revealed that both alleles are expressed equally and that no splice defect could be seen (Fig. 3d). Hereditary Diffuse Leukoencephalopathy with Spheroids of the Swedish type (HDLS-S) is a devastating adult-onset leukoencephalopathy. Its histopathology supports its relationship to neuraxonal degenerations, a group currently breaking up in several nosographic units defined by genetics. Here we demonstrate that the p.Cys152Phe variant in AARS is the likely cause of HDLS-S, thus separating this nosographic entity from CSFR1R related HDLS/ALSP. At the present time, no systematic studies have yet distinguished the phenotypes of HDLS/ALSP and HDLS-S. Both have adult onset, with average age at HDLS/ALSP onset of 43 years and average age at onset for HDLS-S of 40; and average age at death of 53 and 55 years, respectively. Both diseases present an insidious course with an initial frontal lobe or cognitive syndrome of varying duration developing into a variable focal, multisystem encephalopathy, where reported Parkinsonian features in the CSF1R-related HDLS/ALSP cases may correspond to extrapyramidal and dystonic features in HDLS-S [4, 14, 33,34,35]. However, recently reported MRI characteristics may be unique for HDLS-S [36]. Results from the postmortem examination of the brain apparently represented a late outcome of the disease after many years of vegetative state. The white matter was nearly completely liquified in the cerebrum and pyramidal tracts but some regions such as the subcortical white matter, the cerebellum and ascending tracts in the spinal cord were less affected. In a previous study on this patient (case 1 reported here) based on five consecutive MRI examinations performed 10 to 26 months after symptom onset, diffusion tensor imaging (DTI) sequences showed that a centrifugally expanding front of diffusion abnormalities appeared around the anterior ventricular horns [36]. Eventually, similar peripherally progressing changes occurred in the posterior white matter. The rim showed marked restriction of diffusivity suggestive of hypercellularity, and behind the rim was an enlarging center of marked increase in both axial and radial diffusivity indicating general tissue destruction and extensive damage to white matter integrity. At the time of the last MRI examination, 7 years before death, the patient was in the hyperactive stage. We performed no further imaging tests during the subsequent, extremely protracted, terminal stages. The results from the postmortem investigation demonstrated that there was increased cellularity including astrocytes and numerous large lipofuscin containing macrophages in the rim region. We suggest that the hypercellular rim identified by DTI may have expanded slowly further towards the cortex, and that it anatomically corresponds to the preserved subcortical white matter with increased cellularity demonstrated histologically (Fig. 2). For some years, the decisive dividing criterion between HDLS/ALSP and HDLS-S remained the negative findings of CSF1R mutations in HDLS-S. Here we report that a novel heterozygous p.Cys152Phe variant in AARS is the most likely cause of HDLS-S. AARS encodes the alanyl-tRNA synthetase, responsible for the attachment of alanine to its cognate tRNA, in the first step of protein translation. This enzyme has two important domains where the majority of disease-associated mutations are located: the aminoacylation domain responsible for the ligation of the amino acid to tRNA, and the editing domain that hydrolyses mischarged tRNA [10]. Dominant mutations in this gene have been described as affecting the peripheral nervous system causing Charcot-Marie-Tooth disease (CMT) type 2 [16], other hereditary neuropathies, and an indolently progressive, mild form of myeloneuropathy [24]. Axonal degeneration is a common feature for HDLS-S and CMT2N, however no signs of neurodegeneration were observed in the peripheral nervous system specimens (nerve roots and sciatic nerves) from the HDLS-S case 1 examined here. The cellular location of the enzyme is in the perikaryon (Nissl substance), with a very high demand for protein synthesis for the axon, but also in dendrites and spines. However, studies on the relationship between disturbed protein biosynthesis or modification in the perikaryon and specific structures in peripheral nerves are still immature [40]. Furthermore, bi-allelic mutations in AARS have also been associated with more severe recessive early-onset epileptic encephalopathies with hypomyelination [25, 31]. The exact mechanism(s) linking the mutations to the different phenotypes is still unknown. The mutations identified so far are distributed equally across the protein without a clear correlation with the different phenotypes (Fig. 4) and the majority decreases the aminoacylation activity (p.Asn71Tyr, p.Lys81Thr, p.Arg329His, p.Tyr690Leufs*3, p.Arg751Gly and p.Gly913Asp), or the editing activity (p.Tyr690Leufs*3) of the protein (Table 1). However, p.Glu337Lys was described to be a gain-of-function mutation, increasing the catalytic efficiency of aminoacylation and leading to an aberrant morphology and neurologic phenotype in zebrafish [41]. Reduced protein expression (p.Tyr690Leufs*3 and p.Gly913Asp) [25] or formation of aggregates (p.Asn71Tyr) [37] have also been observed. The p.Cys152Phe described here is located in the aminoacylation domain, suggesting a functional impact in the protein aminoacylation activity. Expression analysis at transcript level showed no splicing alterations and the expression of both alleles in brain tissue. Experimental studies are necessary to evaluate the specific consequences of this variant to protein function. Lee et al. (2006) showed that sticky (sti) mutant mice carrying a point mutation (p.Ala734Glu) in the editing domain of AlaRS have ubiquitinated protein aggregates in cerebellar Purkinje cells, resulting in the degeneration of these neurons and ataxia [17]. This missense mutation was located in the editing domain of the protein and was shown to compromise the proofreading activity of this enzyme during aminoacylation of tRNAs. These findings provided a novel mechanism underlying neurodegeneration, caused by accumulation of misfolded proteins and cell death resulting from the disruption of translational fidelity in terminally differentiated neurons. Mutations in other tRNA synthetases have also been associated with leukoencephalopathy. Several cases of adult-onset leukodystrophy were recently shown to be caused by bi-allelic mutations in AARS2, the gene encoding the mitochondrial alanyl-tRNA synthetase, expanding the spectrum of adult onset neuroaxonal degeneration disorders [6, 7, 20, 28]. The clinical phenotypes of CSF1R and AARS2 related ALSPs showed minor differences [15], sharing major clinical, imaging, and pathologic features, such as cognitive and motor symptoms [20]. While the histological hallmark of neuraxial degeneration with spheroids is common to the three disorders: AARS2 leukoencephalopathy, CSF1R related HDLS/ALSP, and HDLS-S (with the latter two expected to be most closely related), some differences have been observed, including an earlier age of onset of leukodystrophy (third decade of life) in addition to ovarian failure associated to AARS2 mutations [15]. Systematic comparison of MRI phenotypes showed more brain stem and deeper gray matter lesions in AARS2 disease [15]. Early white matter lesions may be more symmetric in HDLS-S, and the centrifugal periventricular rim of low diffusion observed in case 1 [33, 36] was not observed in HDLS/ALSP or in AARS2, although similar consecutive DTI studies were not performed in these diseases [7]. Small cerebral calcifications with stepping-stone appearance were described in HDLS/ALSP; the present investigation did not include high-resolution computerized tomography required to search for such calcifications [14]. The frequency of HDLS-S cases in generation IV is unexpectedly low, given the previous assessments of the family. The number of well-documented cases in family members of generations II, III and IV were 4/9, 4/24 and 2/41 (Fig. 1). In families with high degrees of organic psychiatric morbidity, including suicides, it may be difficult to track offspring. However, the segregation pattern in the geographically less scattered descendants of II:9 followed and analyzed at our department, comprising cases 1 and 2 in the present study, is compatible with a dominant pattern of inheritance and high penetrance.
1850
dbpedia
1
86
https://mayoclinic.elsevierpure.com/en/publications/leukoencephalopathy-with-spheroids-hdls-and-pigmentary-leukodystr
en
Leukoencephalopathy with spheroids (HDLS) and pigmentary leukodystrophy (POLD): A single entity?
https://mayoclinic.elsevierpure.com/skin/headerImage/
https://mayoclinic.elsevierpure.com/skin/headerImage/
[ "https://mayoclinic.elsevierpure.com/skin/headerImage/" ]
[]
[]
[ "" ]
null
[ "C. Wider", "J. A. Van Gerpen", "S. Dearmond", "E. A. Shuster", "D. W. Dickson", "Z. K. Wszolek" ]
null
en
Mayo Clinic
https://mayoclinic.elsevierpure.com/en/publications/leukoencephalopathy-with-spheroids-hdls-and-pigmentary-leukodystr
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) present as adult-onset dementia with motor impairment and epilepsy. They are regarded as distinct diseases. We review data from the literature that support their being a single entity. Apart from a slightly older age at onset, a more rapid course, and more prominent pyramidal tract involvement, familial POLD is clinically similar to HDLS. Moreover, the pathologic hallmarks of the two diseases, axonal spheroids in HDLS and pigmented macrophages in POLD, can be identified in both conditions. This supports HDLS and POLD being referred collectively as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP). TY - JOUR T1 - Leukoencephalopathy with spheroids (HDLS) and pigmentary leukodystrophy (POLD) T2 - A single entity? AU - Wider, C. AU - Van Gerpen, J. A. AU - Dearmond, S. AU - Shuster, E. A. AU - Dickson, D. W. AU - Wszolek, Z. K. PY - 2009/6/2 Y1 - 2009/6/2 N2 - Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) present as adult-onset dementia with motor impairment and epilepsy. They are regarded as distinct diseases. We review data from the literature that support their being a single entity. Apart from a slightly older age at onset, a more rapid course, and more prominent pyramidal tract involvement, familial POLD is clinically similar to HDLS. Moreover, the pathologic hallmarks of the two diseases, axonal spheroids in HDLS and pigmented macrophages in POLD, can be identified in both conditions. This supports HDLS and POLD being referred collectively as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP). AB - Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) present as adult-onset dementia with motor impairment and epilepsy. They are regarded as distinct diseases. We review data from the literature that support their being a single entity. Apart from a slightly older age at onset, a more rapid course, and more prominent pyramidal tract involvement, familial POLD is clinically similar to HDLS. Moreover, the pathologic hallmarks of the two diseases, axonal spheroids in HDLS and pigmented macrophages in POLD, can be identified in both conditions. This supports HDLS and POLD being referred collectively as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP). UR - http://www.scopus.com/inward/record.url?scp=67650066957&partnerID=8YFLogxK UR - http://www.scopus.com/inward/citedby.url?scp=67650066957&partnerID=8YFLogxK U2 - 10.1212/WNL.0b013e3181a826c0 DO - 10.1212/WNL.0b013e3181a826c0 M3 - Review article C2 - 19487654 AN - SCOPUS:67650066957 SN - 0028-3878 VL - 72 SP - 1953 EP - 1959 JO - Neurology JF - Neurology IS - 22 ER -
1850
dbpedia
3
5
https://www.cdc.gov/cholesterol/about/ldl-and-hdl-cholesterol-and-triglycerides.html
en
LDL and HDL Cholesterol and Triglycerides
https://www.cdc.gov/chol…cial.jpg?_=98669
https://www.cdc.gov/chol…cial.jpg?_=98669
[ "https://www.cdc.gov/TemplatePackage/5.0/img/uswds/us_flag_small.png", "https://www.cdc.gov/TemplatePackage/5.0/img/uswds/icon-dot-gov.svg", "https://www.cdc.gov/TemplatePackage/5.0/img/uswds/icon-https.svg", "https://www.cdc.gov/TemplatePackage/5.0/img/logo/logo-notext.svg", "https://www.cdc.gov/TemplatePackage/5.0/img/logo/logo-notext.svg", "https://www.cdc.gov/cholesterol/images/LDL-HDL-social.jpg", "https://www.cdc.gov/TemplatePackage/5.0/img/logo/cdc-logo-tag-right.svg" ]
[]
[]
[ "" ]
null
[]
2024-05-20T12:25:16-04:00
Learn about the lipoproteins that carry cholesterol in the blood, called LDL and HDL, and what triglycerides are.
en
/TemplatePackage/5.0/img/favicon/apple-touch-icon.png
Cholesterol
https://www.cdc.gov/cholesterol/about/ldl-and-hdl-cholesterol-and-triglycerides.html
What are triglycerides? Triglycerides are a type of fat in your blood that your body uses for energy. The combination of high levels of triglycerides with low HDL and/or high LDL cholesterol levels can increase your risk for health problems, such as heart attack. Learn more about optimal blood cholesterol and triglyceride levels. How do I lower my risk for high cholesterol and triglycerides? You can work to prevent high cholesterol and triglycerides by reducing risk factors that are in your control. You can make healthy lifestyle decisions, such as choosing healthier foods with less saturated fat and quitting smoking. If you already have high LDL cholesterol and triglyceride levels, your health care team may recommend medicines that treat high cholesterol and triglyceride levels and lifestyle changes to lower your risk for heart disease and stroke. If you already have low HDL cholesterol levels, talk with your doctor about lifestyle changes that may help raise your levels. Getting your cholesterol checked regularly is an important way to stay in control of your cholesterol health. Work with your health care team on how often you should get screened.
1850
dbpedia
3
70
https://familydoctor.org/condition/cholesterol/
en
High Cholesterol: Symptoms, Causes and Treatment
https://familydoctor.org…ly-at-dinner.jpg
https://familydoctor.org…ly-at-dinner.jpg
[ "https://familydoctor.org/wp-content/themes/familydoctor-child/images/logo.svg", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/logo.svg", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/icon-search-orange.png", "https://familydoctor.org/wp-content/uploads/2016/11/clock-250x170.jpg", "https://familydoctor.org/wp-content/uploads/2000/09/5464810_l-250x170.jpg", "https://familydoctor.org/wp-content/uploads/2016/11/bottle-pills-250x170.jpg", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/[email protected]", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/chevron.png", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/arrow-down.png", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/arrow-up.png", "https://familydoctor.org/wp-content/uploads/1996/01/family-at-dinner-566x566.jpg", "https://familydoctor.org/wp-content/uploads/2010/01/admin-logo.png", "https://familydoctor.org/wp-content/uploads/2016/11/FD-Logo-White.png", "https://familydoctor.org/wp-content/uploads/2016/11/aafp-e1520870301332.png", "https://familydoctor.org/wp-content/uploads/2016/11/aafp-foundation-e1520869366904.png", "https://familydoctor.org/wp-content/themes/familydoctor-child/images/icon-close.svg", "https://www.facebook.com/tr?id=297209990620305&ev=PageView&noscript=1", "https://www.facebook.com/tr?id=568027847384514&ev=PageView&noscript=1" ]
[]
[]
[ "" ]
null
[ "familydoctor.org editorial staff" ]
1996-01-01T05:00:00+00:00
High cholesterol is a medical condition that can lead to stroke and heart disease. Many people are unaware they have high cholesterol.
en
https://familydoctor.org…/favicon16-1.png
familydoctor.org
https://familydoctor.org/condition/cholesterol/
Cholesterol is a waxy substance your liver makes to protect nerves and to make cell tissue and certain hormones. Your body also gets cholesterol from the food you eat. This includes eggs, meats, and dairy. There is “good” (HDL) cholesterol and “bad” (LDL) cholesterol. Too much bad cholesterol (LDL) can be bad for your health. What is the difference between “good” cholesterol and “bad” cholesterol? Good cholesterol is known as high-density lipoprotein (HDL). It removes cholesterol from the bloodstream. Low-density lipoprotein (LDL) is the “bad” cholesterol. If your total cholesterol level is high because of a high LDL level, you may be at higher risk of heart disease or stroke. But, if your total cholesterol level is high only because of a high HDL level, you’re probably not at higher risk. Triglycerides are another type of fat in your blood. When you eat more calories than your body can use, it turns the extra calories into triglycerides. Changing your lifestyle (diet and exercise) can improve your cholesterol levels, lower LDL and triglycerides, and raise HDL. Your ideal cholesterol level will depend on your risk for heart disease. Total cholesterol level – less than 200 is best, but it depends on your HDL and LDL levels. LDL cholesterol levels – less than 130 is best, but this depends on your risk for heart disease. HDL cholesterol levels – 60 or higher reduces your risk for heart disease. Triglycerides – less than 150 milligrams per deciliter (mg/dl) is best. Often, there are no specific symptoms of high cholesterol. You could have high cholesterol and not know it. If you have high cholesterol, your body may store the extra cholesterol in your arteries. These are blood vessels that carry blood from your heart to the rest of your body. A buildup of cholesterol in your arteries is known as plaque. Over time, plaque can become hard and make your arteries narrow. Large deposits of plaque can completely block an artery. Cholesterol plaques can also break apart, leading to formation of a blood clot that blocks the flow of blood. A blocked artery to the heart can cause a heart attack. A blocked artery to your brain can cause a stroke. Many people don’t discover that they have high cholesterol until they suffer one of these life-threatening events. Some people find out through routine check-ups that include blood tests. Your liver produces cholesterol, but you also get cholesterol from food. Eating too many foods that are high in fat can increase your cholesterol level. Being overweight and inactive also causes high cholesterol. If you are overweight, you most likely have a higher level of triglycerides. If you never exercise and aren’t active in general, it can lower your HDL (good cholesterol). Your family history also affects your cholesterol level. Research has shown that high cholesterol tends to run in families. If you have an immediate family member who has it, you could have it, too. Smoking also causes high cholesterol. It lowers your HDL (good cholesterol). You can’t tell if you have high cholesterol without having it checked. A simple blood test will reveal your cholesterol level. Men 35 years of age and older and women 45 years of age and older should have their cholesterol checked. Men and women 20 years of age and older who have risk factors for heart disease should have their cholesterol checked. Teens may need to be checked if they are taking certain medicines or have a strong family history of high cholesterol. Ask your doctor how often you should have your cholesterol checked. Risk factors for heart disease include: Cigarette smoking High blood pressure Older age Having an immediate family member (parent or sibling) who has had heart disease Being overweight or having obesity Inactivity Making healthy food choices and exercising are two ways to reduce your risk of developing high cholesterol. Eat fewer foods with saturated fats (such as red meat and most dairy products). Choose healthier fats. This includes lean meats, avocados, nuts, and low-fat dairy items. Avoid foods that contain trans fat (such as fried and packaged foods). Look for foods that are rich in omega-3 fatty acids. These foods include salmon, herring, walnuts, and almonds. Some egg brands contain omega-3. Exercise can be simple. Go for a walk. Take a yoga class. Ride your bike to work. You could even participate in a team sport. Aim to get 30 minutes of activity every day.
1850
dbpedia
1
69
https://leukodystrophyresourceresearch.org/types-of-leukodystrophy/neuroaxonal-leukoencephalopathy-with-axonal-spheroids-hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
en
Neuroaxonal Leukoencephalopathy with Axonal Spheroids (Hereditary Diffuse Leukoencephalopathy with Spheroids – HDLS)
https://leukodystrophyre…2299-6-32x32.jpg
https://leukodystrophyre…2299-6-32x32.jpg
[ "https://leukodystrophyresourceresearch.org/wp-content/uploads/2021/01/logo_leu3.png", "https://leukodystrophyresourceresearch.org/1608428280142/wp-content/uploads/2020/12/logo_leu3-e1609248319273.png" ]
[]
[]
[ "" ]
null
[]
null
en
/wp-content/uploads/2018/07/cropped-12299-6-32x32.jpg
https://leukodystrophyresourceresearch.org/types-of-leukodystrophy/neuroaxonal-leukoencephalopathy-with-axonal-spheroids-hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
What Causes Neuroaxonal Leukoencephalopathy with Axonal Spheroids Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease. The disease was described for the first time in multiple members of a large Swedish pedigree in 1984 (Axelsson et al, 1984). In this family, 17 of 71 subjects from 4 generations were affected. The age at onset varied from 8 to 60 years with a mean of 36 years. The age at death was 39 to 89 years with a mean of 57 years. The time between onset and death varied from 3 months to over 30 years. Some patients rapidly developed severe dementia and died a few months after the onset of symptoms, whereas in others the course was prolonged with dementia developing over decades. Sporadic patients have also been reported. The predominant clinical manifestations are psychiatric and include depression, anxiety, alcohol abuse, irritability, and aggressiveness. Psychotic symptoms may occur with confusion, delusions, and hallucinations. The most frequent neurologic symptoms are dementia, seizures, impaired balance, retropulsion, gait apraxia, spasticity, ataxia, and urinary incontinence. Extrapyramidal symptoms may occur with hyperkinesia, chorea, tremor and oral dyskinesia. EEG usually shows nonspecific abnormalities with slowing of the background pattern and sometimes paroxysmal changes. The abnormalities often have a frontotemporal predominance. They may be asymmetrical. Routine and metabolic laboratory investigations reveal no abnormalities. The diagnosis is at present based on histopathologic findings. Pathology External examination of the brain shows mild atrophy of the frontoparietal regions. The thalamus and the rostral part of the caudate nucleus may be mildly reduced in size. The lateral ventricles are moderately enlarged. The corticospinal tracts and the basis of the pons are atrophic. On microscopy, a widespread leukoencephalopathy is found, characterized by a commensurate loss of myelin sheaths and axons and the presence of numerous neuroaxonal spheroids in the affected white matter. Neuroaxonal spheroids are round to sausage-shaped axonal swellings, which are easily identified with Bielschowsky, Bodian, and anti-neurofilament immunostatins. The leukoencephalopathy is most severe in the frontal, frontoparietal and temporal areas and may be mildly asymmetrical. The U-fibres are relatively spared. The abnormalities tend to be most pronounced in the white matter below the pre- and postcentral gyri and extend through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The corpus callosum is variably affected. The abnormal white matter may show vacuolization. Reactive astrocytes and macrophages are present, but no inflammatory cells. The cerebral cortex and basal ganglia are normal and contain no or only few spheroids. Within the cerebellum, a marked loss of Purkinje cells is seen, but the cerebellar white matter is normal. Electron microscopy of the spheroids reveals neurofilaments scattered among electron-dense material and mitochondria. Pathogenetic Considerations The homogeneity of the clinical picture and histopathologic findings strongly suggests that HDLS is a distinct disease entity. The disease has an autosomal dominant mode of inheritance. Isolated cases are probably the result of new mutations. The genetic defect and the pathophysiology of HDSL are as yet unresolved. Considering the more or less commensurate loss of axons and myelin sheaths, the preferential involvement of long tracts and the presence of axonal swellings, it is likely that axons are the primary target of the disease. Axonal spheroids are pathologic findings characteristic of the neuroaxonal dystrophies. They occur most often in the context of neuronal degenerative disorders, such as infantile neuroaxonal dystrophy (Seitelberger disease) and Hallervorden-Spatz disease. The combination of a leukoencephalopathy and neuroaxonal spheroids in the abnormal white matter is rare. Apart from HDSL, this combination is observed in dermatoleukodystrophy with neuroaxonal spheroids (Matsuyama et al, 1978) and polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (Nasu-Hakola disease). Both disorders are clinically different form HDLS. How is Neuroaxonal Leukoencephalopathy with Axonal Spheroids Treated? Supportive care is the only therapeutic option. Magnetic Resonance Imaging MR images demonstrate signal abnormalities bilaterally within the cerebral white matter, either most pronounced within the white matter under the pre- and postcentral gyri, or within the frontal white matter. The signal abnormalities may be patchy or more confluent, and may be symmetrical or asymmetrical. They are ill-defined. The corpus callosum is thin and may contain areas of abnormal signal. The signal abnormalities extend downwards through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The affected cerebral white matter is atrophic with widening of the lateral ventricles and subarachnoid spaces. The head of the caudate nucleus may be flattened. There may be cerebellar atrophy. The above MRI findings may confirm the diagnosis within a pedigree with known HDLS. However, the MRI findings in itself are not specific and do not allow definite diagnosis. The diagnosis needs to be confirmed by histopathology. The differential diagnosis of HDLS includes disorders with frontal cortical degeneration, such as frontotemporal dementia and Pick disease. In these disorders MRI shows atrophy of mainly the frontotemporal areas. Sometimes there are additional white matter changes, which are ill-defined and usually mild. If present, they make differentiation from HDLS difficult. The differential diagnosis also includes disorders with frontal lobe dysfunction caused by white matter degeneration, such as metachromatic leukodystrophy, X-linked adrenoleukodystrophy with frontal predominance, Nasu-Hakola disease (PLOSL), Binswanger disease, CADASIL, orthochromatic pigmentary leukodystrophy, and adult onset autosomal dominant leukodystrophies. Most disorders can be ruled out by typical clinical, physical and laboratory findings and neuroimaging differences. Some disorders require histopathologic confirmation. Courtesy of Van der Knaap et al, Neurology 2000; 54: 463-468, with permission Want to Discuss Further? Please contact us using the form below
1850
dbpedia
1
7
https://journals.lww.com/md-journal/fulltext/2019/05310/diagnosis_of_hereditary_diffuse.40.aspx
en
Medicine
https://images.journals.…10-00040.F1.jpeg
https://images.journals.…10-00040.F1.jpeg
[ "https://cdn.wolterskluwer.io/wk-logos/1.0.x/favicon.png?rev=43", "https://journals.lww.com/_layouts/15/images/spcommon.png?rev=43", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F1.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F2.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F3.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.F4.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.T1.jpeg", "https://images.journals.lww.com/md-journal/ArticleViewerPreview.00005792-201905310-00040.T2.jpeg", "https://images.journals.lww.com/md-journal/XLargeThumb.00005792-202408160-00000.CV.jpeg", "https://journals.lww.com/_layouts/1033/IMAGES/OAKS.Journals/CAPrivacyPolicy.png" ]
[]
[]
[ "" ]
null
[]
null
erogeneities; also, it is classed as a neurodegenerative disease. Patient concerns: In preliminary clinical work, we identified a family with rapid progressive dementia. Diagnosis: Within this family, all patients had a CSF1R gene c.2696delA mutation (a deletion mutation), and head magnetic resonance imaging showed extensive white matter lesions. We diagnosed these patients with HDLS. Interventions: The proband was given hormonal treatments and immunoglobulin therapy, and his dementia symptoms have been relieved to a certain extent. Outcomes: After treatment, the symptoms of dementia were still progressively aggravated. However, the mutation site has not previously been reported. Lessons: This newly discovered mutation site may provide a new basis for the genetic diagnosis of HDLS disease in clinical work....
en
https://cdn.wolterskluwe….0.x/favicon.png
LWW
https://journals.lww.com/md-journal/fulltext/2019/05310/diagnosis_of_hereditary_diffuse.40.aspx
1 Introduction Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids (HDLS) is a rare disease involving white matter lesions of the central nervous system, and it is usually inherited in an autosomal dominant fashion. It is a neurodegenerative disease with obvious clinical and genetic heterogeneities, and it has a complex pathogenesis and causes. More than 20 mutation sites related to this disease have been identified in colony-stimulating factor 1 receptor (CSF1R), located on chromosome 5q32.[1] Gene detection and pathological examination of brain tissue are needed for a definitive diagnosis of this disease. In our preliminary clinical work, we identified a family in which the proband and his mother both had rapid progressive dementia and extensive leukoencephalopathy as observed by head magnetic resonance imaging (MRI). We ran gene sequencing on family members and identified a CSF1R gene c.2696delA deletion mutation in the proband, and his mother and son. We thus diagnosed them with HDLS, although this mutation site has not been reported in previous literature. The cases are reported as follows. The case report was approved by the Ethics Committee of China-Japan Union Hospital of Jilin University, and all examinations of the patient were approved by the patient himself. Written informed consent was obtained from the patients. He also provided informed consent for publication of the findings. 2 Case report 2.1 Proband A 43-year-old male received treatment for 1 year because of progressive mental decline and character changes. The patient was admitted to hospital 1 year before this study, when he reported that his work was not satisfying, and he had memory deterioration, speech reduction, slow responses, character changes, irascibility, and unwillingness to communicate with people; he also expressed that “some people want to hurt me.” As the patient's condition worsened, he could no longer work. He underwent head MRI and other related examinations in another hospital and was diagnosed with leukoencephalopathy, and he was given symptomatic treatment including hormone and neurotrophic therapies; however, the patient's condition did not improve. 2.2 Physical examination The proband's blood pressure was 120/80 mm Hg, and his directive force, memory, and calculation ability were poor. His Mini-Mental State Examination (MMSE) score was 18 points (education <6 years) and he had cognitive deficiencies, and his clinical dementia rating (CDR) was 6 points. The patient was conscious, but had reduced speech capabilities. No obvious abnormalities were seen in the cranial nerve through physical examination, the muscular tension of all 4 limbs was normal, muscle force was level 5, no pathological reflexes were observed, and physical examination revealed no obvious abnormalities in residual nervous systems. 2.3 Head MRI scan and diffusion after admission to hospital In the left basal ganglia and bilateral corona radiata regions, there were multiple patchy long T1 and T2 signal shadows with well-demarcated margins. With FLAIR, there was a slightly high signal, and using DWI there was a patchy, slightly high signal; the regions around the anterior and posterior horns of the lateral ventricle were the most prominent. Using DWI, multiple patchy high signals in the bilateral frontal lobes and the left occipital lobe could be observed with well-demarcated margins. In addition, the genu of the corpus callosum had a slightly lower signal change in disseminated T1WI (Fig. 1). The lesion range was slightly increased compared with images at 3 months before admission. 2.4 Routine test of cerebrospinal fluid (CSF) In the proband, oligoclonal bands were negative, oligoclonal serum bands were negative, IgG synthesis rate of CSF was within the normal range, and AQP4 antibody was negative. Serum myelin basic protein levels were increased, autoantibody of myelin basic protein was positive, MOG antibody was positive, and blood–brain barrier permeability was elevated. No abnormalities were observed in 2 routine examinations and biochemical tests of CSF. 2.5 Proband's mother The proband's mother was a 70-year-old female who had received treatment for progressive mental decline and character changes for 10 years. The patient had poor memory ability and had changed from being well-spoken to being taciturn, unsociable, and short-tempered over the course of 10 years before being admitted into hospital. Her condition gradually worsened, and she eventually could not take care of herself. 2.6 Physical examination The patient's blood pressure was 145/90 mm Hg, and her directive force, memory, and calculation ability were poor. Her MMSE score was 15 points (education <6 years) and she had cognitive deficiencies, and her CDR was 5 points. The patient was conscious and could speak fluently. No obvious abnormalities were observed in the cranial nerve through physical examination, muscular tension of all 4 limbs was normal, muscle force was level 5, no pathological reflexes were observed, and physical examination revealed no obvious abnormalities in residual nervous systems. 2.7 Head MRI scan and diffusion In the bilateral frontal and parietal lobes, there was interspersed mottling and patchy equal or long T1 signal and slightly long T2 signal with obscure boundaries, and with FLAIR there was a slightly high signal. Laminated long T1 and T2 signal shadows could be observed in the temporal lobe, and there was a high signal using FLAIR; laminated long T1 and T2 signals could be observed within the lesion, and boundaries were obscure. Within the brainstem, body and genu of the corpus callosum, bilateral thalami, basal ganglia, corona radiata, and centrum semiovale, patchy and laminated long T1 and T2 signal shadows could be observed with obscure boundaries, and with FLAIR, there were low or high signal shadows. Within the left basal ganglia region, there were obvious long T1 and T2 signal shadows with arc-shaped signal loops, and where the bilateral lateral ventricles broadened, patchy long T1 and T2 signal shadows could be observed. With FLAIR, there was a high signal with obscure boundaries (Fig. 2). 2.8 Family survey A family survey was conducted after the informed consent of each family member, and each patient/family member provided informed consent for publication of the case. In the family, there were 12 nonsymptomatic members and 3 symptomatic patients, including 1 male (the proband) and 2 females (as shown in Fig. 3). The elder sister of the proband is deceased, but before her death, she gradually developed character changes and memory loss, and had rapid disease progression that meant that she could not take care of herself after 1 year of developing symptoms; she died 5 years before the current study was conducted. For all 3 symptomatic family members, there were no other clinical manifestations and they were healthy before developing symptoms. All nonsymptomatic family members had no obvious clinical symptoms. The proband and his mother both had rapidly progressing dementia, and their head MRIs showed extensive leukoencephalopathy; the proband also had a questionable medical history of nervous shock and psychological problems caused by the postnatal environment; however, his symptoms were similar to those of his sister, and his symptoms and imaging manifestations were also similar to those of his mother. Thus, the possibility of a hereditary disease was considered to be high (Fig. 3), and next-generation sequencing was performed in the proband and his mother to detect genes related to dementia. 2.9 The next-generation sequencing A standard phenol-chloroform extraction method was used to extract genomic DNA from peripheral blood. Next-sequencing was performed by Novogene Bioinformatics Institute. Following the manufacturer's procedures, more than 1.5 μg of genomic DNA from each sampled individual was cut by using a sonicator (Covaris); enriched, hybridized, and captured on the Agilent SureSelect Human All Exon V5; and sequenced using the Illumina HiSeq 2000 sequencer (Illumina Inc., San Diego, CA). Clean reads without adaptors or degraded readings were mapped to the human reference genome (UCSC hg19) using the Burrows-Wheeler alignment (BWA) tool. Single-nucleotide polymorphism (SNP) and insertions/deletions were identified by sequence alignment/map tools and then the identification process was repeated using Picard tag reading. We screened all variants against the SNP database, 1000 Genomes project, and the outer NHLBI exome sequencing projects (ESP) 6500. Functional prediction was carried out by Sorting Intolerant from Tolerant (SIFT) and Polymorphism Phenotyping version 2 (PolyPhen-2). Candidate variants were annotated by the ANNOVAR (Annotate Variation) software. Direct Sanger sequencing was then performed using an ABI 3500 sequencer (Applied Biosystems, Foster City, CA) to identify the CSF1R gene in the family. We revealed that both the proband and his mother had a heterozygous mutation of c.2696delA in the CSF1R gene (Fig. 4, Tables 1 and 2), and discovered the existence of a new mutation site—c.2696delA (a deletion mutation)—in CSF1R in the patient, which leads to the amino acid change p.His899fs (a frame-shift mutation). After consulting related articles and HGMDpro database, we could find no previous reports of this mutation. On the basis of the clinical characteristics, and also the results of imaging examinations and gene detection, the proband was diagnosed with HDLS and given steroid pulse therapy and immunoglobulin, which slightly relieved his dementia symptoms. During a follow-up visit 3 months after diagnosis, the patient's condition was observed to have gradually worsened, and the patient currently has difficulty communicating and cannot take care of himself in daily life, or relieve his bowels. 2.10 Ethical statement Ethics Committee of China-Japan Union Hospital of Jilin University has approved this study (the ethical approval number is 2019040810). 3 Discussion Hereditary diffuse leukoencephalopathy with neuroaxonal spheroids is a hereditary degenerative disease of the nervous system that mainly manifests as rapidly progressing dementia, and it was reported both clinically and pathologically for the first time in 1984.[2] The major pathological feature of this disease is extensive leukoencephalopathy with neuroaxonal spheroids or demyelination. The main clinical manifestations include progressive cognitive impairments such as aphasia and dementia, and also motor impairments such as dyskinesia, Parkinson disease, and dystaxia because of the influence of the pyramidal tract; some patients may even have epileptic seizures.[3–5] The age of onset is generally between 30 and 50 years, and disease development is rapid: in most cases, the patient dies within a few years, and there are only a few reported cases of patients who have lived with the disease for decades.[2] HDLS is usually autosomal-dominant. CSF1R has been determined as a causative gene,[1] and the CSF1R protein that it encodes is a polypeptide containing 972 amino acids, and is a type III tyrosine kinase receptor that belongs to the platelet-derived growth factor (PDGF) receptor family. This receptor mainly influences the proliferation and differentiation of mononuclear macrophages and neurogliocytes.[6] The CSF1R gene is a common causative gene of HDLS, although there are other known causative genes including EIF2B2 and POLR3A.[7] In theory, a pathogenic mutation in just 1 chromosome may result in the disease. In 2012, Rademakers et al confirmed CSFlR as a causative gene of HDLS and reported that it is located on chromosome 5q32 and includes 22 exons. However, a later study confirmed that there are, in fact, 24 exons. Studies by Konno et al[8] reported that CSF1R mutations may play a role in the pathogenesis of HDLS by causing the dysfunction of microglial phagocytic (or “gitter”) cells, no matter what type of CSF1R mutation a patient might have or what clinical characteristics or neuroimaging features are observed. Until now, it has been reported that mutations in more than 60 genes can lead to leukoencephalopathy, among which NOTCH3, EIF2B5, AARS2, and CSF1R are the most common genes.[9] In CSF1R, more than 50 mutations can lead to disease states, and of these, 21 mutation sites are related to leukoencephalopathy. These include point mutations, missense mutations, and frame-shift mutations. In preliminary clinical work, we identified a rare HDLS family and discovered the existence of a new mutation site—c.2696delA (a deletion mutation)—in CSF1R in the patient, which leads to the amino acid change p.His899fs (a frame-shift mutation) and the deletion of CSF1R genes related with tumor-like lesions. After consulting related articles and mutation databases, we could find no previous reports of this mutation. This newly discovered mutation site provides a new basis for the genetic diagnosis of HDLS disease in the clinic. Genetic analysis suggested that the family in the current study conformed to the characteristics of autosomal dominant inheritance. The proband, his mother, and his son all carried this mutation, and the symptoms of his elder sister were similar to the symptoms of the proband; she is thus likely to have also suffered from this disease before her death. The proband's son is 15 years old and carries the gene mutation without any clinical symptoms of HDLS; it is considered that he has not yet reached the age of onset, and follow-up observations will continue for this individual. At present, there are no effective therapeutic drugs for this disease, and symptomatic treatment is the current treatment method. Apart from routine circulation improvement and neurotrophic drug therapy, the proband has also received hormonal treatments and immunoglobulin therapy, and his dementia symptoms have been relieved to a certain extent; however, his continuous deterioration cannot be reversed. We will continue to arrange follow-up treatment for this patient and the other mutation carriers in the family. In this study, there were the following limitations. First, the family members who underwent gene sequencing were few, and we were unable to perform gene sequencing on the father, brothers, and sisters of the proband, even after concerted efforts. Second, we were unable to perform pathological examination of the proband's brain tissue. Third, we did not further explore the possibly rare inheritance modes of HDLS. A study by Nicholson et al[7] indicated that the parents of individual HDLS patients do not have similar symptoms, and it is considered that the inheritance modes for some patients are unconventional. A final limitation is that we did not investigate the factors related to the age of onset in carriers of the mutated gene. Karle et al reported that a 28-year-old man carrying a CSF1R mutation was severely ill, but his 69-year-old father with the same mutation did not have similar symptoms and only showed some nonspecific leukodystrophies by MRI. However, it cannot be excluded that the father may develop symptoms at an older age. According to the latest research, the oldest reported age of HDLS onset is 71 years old.[6] Research into factors that may contribute to age of onset is important because it may allow early intervention in patients who carry or may carry disease genes, and could help in genetic counseling and when there is antenatal diagnosis in families. Author contributions Writing – original draft: Tianji Shi.