Update README.md

README.md

@@ -27,8 +27,9 @@ dna_sequences = ["ATCGGAAAAAGATCCAGAAAGTTATACCAGGCCAATGGGAATCACCTATTACGTGGATAATA
 # Generate sequence
 generated_english_sequence = pipe(
     inputs={"english_sequence": english_sequence, "dna_sequences": dna_sequences},
-    english_tokens_max_length=512, # this value is used to pad or truncate the english tokens
-    bio_tokens_max_length=512, # this value is used to pad or truncate the DNA tokens
+    max_num_tokens_to_decode=50, # Max number of tokens to be generated
+    english_tokens_max_length=512, # Used to pad or truncate the english tokens
+    bio_tokens_max_length=512, # Used to pad or truncate the DNA tokens
 )
 ```